AMCG00013363 (prkca,LOC107664393)


Basic Information

Item Value
gene id AMCG00013363
gene name prkca,LOC107664393
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030125.1
NCBI id CM030125.1
chromosome length 49972098
location 29568489 ~ 29573439 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00013363
ATGCCGAGTCCCGATGAGACGCTCTCCGGCGCTTTGTCTGGGAGCAACAAAGGCGTTTGTGACGAGTGTGTGCTCTTGTCTCTGCAGGACCCCCGGAGCAAGCACAAGTTCAAAATCCACACCTATGGGAGTCCGACGTTCTGTGACCACTGCGGCTCCCTGCTGTACGGCCTCATTCACCAGGGGATGAAGTGCGACACTTGTGACATGAATGTCCACAAGCAGTGTGTGATGAATGTGCCCAGCCTGTGCGGGACAGACTACACGGAGAGGAGGGGGCGGCTCTTCTTGAAGATCGAAGTCAGCGGGGACAAGCTGCACGTGACAGGTGGGTCAGGGGGCCGGGGAATGTGA

Function

symbol description
prkca Enables enzyme binding activity; histone kinase activity (H3-T6 specific); and protein kinase C activity. Involved in several processes, including desmosome assembly; histone H3-T6 phosphorylation; and positive regulation of lipopolysaccharide-mediated signaling pathway. Located in cytosol; endoplasmic reticulum; and plasma membrane. Implicated in dilated cardiomyopathy; high grade glioma (multiple); large cell carcinoma; and reproductive organ cancer (multiple). Biomarker of ductal carcinoma in situ; endometrial carcinoma; ovarian carcinoma; and urinary bladder cancer.

NR:

description
PREDICTED: protein kinase C alpha type-like

GO:

id name namespace
GO:0035556 intracellular signal transduction biological_process
GO:0006468 protein phosphorylation biological_process
GO:0005524 ATP binding molecular_function
GO:0008270 zinc ion binding molecular_function
GO:0004697 protein kinase C activity molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00013363 True 354 mRNA 0.58 3 29568489 29573439

Neighbor

gene id symbol gene type direction distance location
AMCG00013356 ern1,LOC106601756,LOC106606681 coding upstream 411904 29150242 ~ 29156585 (+)
AMCG00013352 znf207 coding upstream 447054 29115453 ~ 29121435 (+)
AMCG00013351 ube2o coding upstream 476882 29080000 ~ 29091607 (+)
AMCG00013350 NA coding upstream 500087 29067830 ~ 29068402 (+)
AMCG00013344 NA coding upstream 508849 29033142 ~ 29059640 (+)
AMCG00013365 LOC108437159,LOC101159746,LOC108259727,LOC103469320,LOC102304961,LOC108239241 coding downstream 12812 29586251 ~ 29627558 (+)
AMCG00013367 cacng4,LOC107548710 coding downstream 124393 29697832 ~ 29710210 (+)
AMCG00013368 NA coding downstream 148206 29721645 ~ 29724010 (+)
AMCG00013366 LOC103141692,LOC104946086,LOC108239284,LOC102237380,LOC107097600 coding downstream 159413 29732852 ~ 29741055 (+)
AMCG00013371 pitpnc1,LOC106926703 coding downstream 281454 29854893 ~ 29860612 (+)
G43895 NA non-coding upstream 121791 29434050 ~ 29446698 (+)
G43855 NA non-coding upstream 365768 29179098 ~ 29202721 (+)
G43853 NA non-coding upstream 390223 29177051 ~ 29178266 (+)
G43799 NA non-coding upstream 409996 29156699 ~ 29158493 (+)
G43810 NA non-coding upstream 417155 29149978 ~ 29151334 (+)
G44182 NA non-coding downstream 882233 30455672 ~ 30457671 (+)
G44306 NA non-coding downstream 1161097 30734536 ~ 30734795 (+)
G44307 NA non-coding downstream 1163370 30736809 ~ 30737487 (+)
G44322 NA non-coding downstream 1198942 30772381 ~ 30774068 (+)
G44323 NA non-coding downstream 1200743 30774182 ~ 30774548 (+)
G43802 NA other upstream 463912 29104289 ~ 29104577 (+)
AMCG00013336 NA other upstream 882351 28676542 ~ 28686138 (+)
G43682 NA other upstream 1079706 28484273 ~ 28488783 (+)
AMCG00013317 NA other upstream 1495690 28007514 ~ 28072799 (+)
AMCG00013310 NA other upstream 1632551 27928708 ~ 27935938 (+)
AMCG00013364 cacng5,cacng5b,LOC107586339,LOC107569463,LOC107716884,LOC107688812,LOC107710162,LOC108437158,LOC107710696,LOC107698772 other downstream 67184 29640623 ~ 29667051 (+)
AMCG00013375 bptf,LOC105013188,LOC106607015,LOC103359999 other downstream 312323 29885762 ~ 29928697 (+)
AMCG00013382 NA other downstream 489941 30063380 ~ 30074748 (+)
AMCG00013388 NA other downstream 510205 30083644 ~ 30090117 (+)
AMCG00013396 tbc1d16,LOC106597465,LOC106606686 other downstream 645471 30218910 ~ 30229021 (+)

Expression


Co-expression Network