AMCG00013970


Basic Information

Item Value
gene id AMCG00013970
gene name NA
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030125.1
NCBI id CM030125.1
chromosome length 49972098
location 48503169 ~ 48504611 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00013970
ATGACTGGCATTCTGGGATATGACACTGTCACTGTGGCAGGTATCATTGACACCAATCAGATCTTCGGTCTGAGCGAGACAGAGCCCGGTCTCTTCCTGTACTACTCTGAGTCTGATGGGATCCTGGGCCTCTCCTACCCCAGCATCTCTGCATCCGGTGCCACCCCTGTCTTTGACAACATGATGGCCGAAGACCTGGTGTCTCAGGATGTCTTCTCCTTCTACCTCAGCCGCCCAAGTAGCCACACTGGCAGTGTCTTGACCTTCGGTGGGTTTGATTCATCTTACTTCACTGGCGAGATCTACTGGGTACCAGTCACATCGCAGACCTACTGGGAAGTCACCATGTGGTCGGTCTCCATTAATGGCCAAGTGGTGGCGTGTGCAAGCGGTTGCCGGGCAATTGTGGACACTGGCACTTCCCTGGTTGTTGGACCCAGCACCGAAATCACACACATTAACAATCTGCTGGGAGGCACTCAGGGCAACTACGGACAGATTGATGTGAACTGCAATAGTCTTGGGAGCATGCCTGATGTTACCTTCACACTCAATGGATACAACTTTGCTCTCCCTCCATCTGCCTATGTATTCCAG

Function

GO: NA

KEGG:

id description
ko04950 Maturity onset diabetes of the young

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00013970 True 597 mRNA 0.53 5 48503169 48504611

Neighbor

gene id symbol gene type direction distance location
AMCG00013969 NA coding upstream 8857 48490544 ~ 48494312 (+)
AMCG00013963 NA coding upstream 80376 48418257 ~ 48422793 (+)
AMCG00013962 NA coding upstream 263924 48236763 ~ 48239245 (+)
AMCG00013960 NA coding upstream 268942 48227415 ~ 48234227 (+)
AMCG00013951 NA coding upstream 344924 48145398 ~ 48158245 (+)
AMCG00013968 slc16a4,LOC106572850,LOC107591855 coding downstream 42643 48547254 ~ 48572929 (+)
AMCG00013977 NA coding downstream 90992 48595603 ~ 48598036 (+)
AMCG00013975 NA coding downstream 107031 48611642 ~ 48616152 (+)
AMCG00013978 NA coding downstream 210759 48715370 ~ 48726258 (+)
AMCG00013989 NA coding downstream 283862 48788473 ~ 48790311 (+)
G48075 NA non-coding upstream 9130 48493045 ~ 48494039 (+)
G48074 NA non-coding upstream 27721 48472380 ~ 48475448 (+)
G48073 NA non-coding upstream 46289 48455921 ~ 48456880 (+)
G48062 NA non-coding upstream 94360 48407483 ~ 48408809 (+)
G48060 NA non-coding upstream 97351 48405603 ~ 48405818 (+)
G48091 NA non-coding downstream 1260 48505871 ~ 48506198 (+)
G48093 NA non-coding downstream 10081 48514692 ~ 48514910 (+)
G48121 NA non-coding downstream 75360 48579971 ~ 48620338 (+)
G48134 strip1 non-coding downstream 181356 48685967 ~ 48746141 (+)
G48155 NA non-coding downstream 287376 48791987 ~ 48795514 (+)
G48026 NA other upstream 151884 48281063 ~ 48351285 (+)
G48018 NA other upstream 233897 48268754 ~ 48269272 (+)
AMCG00013961 NA other upstream 244736 48239700 ~ 48258433 (+)
AMCG00013943 NA other upstream 683446 47752214 ~ 47819723 (+)
AMCG00013927 LOC108435245,LOC102295207,LOC101474852,LOC101474572,LOC102198786 other upstream 1275200 47219919 ~ 47227969 (+)
AMCG00013971 lamtor5,xip,LOC106566397,LOC107668015 other downstream 29275 48533886 ~ 48546200 (+)
G48142 NA other downstream 250342 48754953 ~ 48760712 (+)
G48150 NA other downstream 271886 48776497 ~ 48778459 (+)
AMCG00013985 NA other downstream 316639 48821250 ~ 48828975 (+)
G48235 LOC105889183 other downstream 510018 49014629 ~ 49095546 (+)

Expression


Co-expression Network