G42440 (dnah9)


Basic Information

Item Value
gene id G42440
gene name dnah9
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030125.1
NCBI id CM030125.1
chromosome length 49972098
location 21893624 ~ 21905597 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU52907
AGTGAGGAAGCCGATCTCCGCATTGGGGTGCAGTCCGTACAGGTTCCGGGCCTACCTGATTGAAGTTGTCCAGGGCCTTGTGCAGGTTTGCGTGCATGCCAGTCGGCGGCTCATTGGTGATTTTGATGGAGTTCTCCAGGATACCCTGAGGAATGATGTGAGCGTCAGCAGTGCCGGCGGGCTCAGCGCTGATGAAGACGCGGAACTCCTGGTTGCTGCCCTCGCTGTGCTGCTCCAGCTTCTTCTCCAGGGTGCTCAGCCATTTGGCCACCAGATGGATATTCTAGTAGGAACAAATGGAC

Function

symbol description
dnah9 Predicted to enable minus-end-directed microtubule motor activity. Acts upstream of or within epithelial cilium movement involved in determination of left/right asymmetry. Is expressed in several structures, including mesoderm; nervous system; neural tube; pleuroperitoneal region; and tail bud. Human ortholog(s) of this gene implicated in primary ciliary dyskinesia 40. Orthologous to human DNAH9 (dynein axonemal heavy chain 9).

NR:

description
PREDICTED: dynein heavy chain 9, axonemal

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU52907 True 302 lncRNA 0.57 2 21893624 21905597

Neighbor

gene id symbol gene type direction distance location
AMCG00013130 NA coding downstream 266228 21596075 ~ 21627396 (-)
AMCG00013141 NA coding downstream 343898 21546040 ~ 21549726 (-)
AMCG00013135 LOC107091756,LOC107691241,LOC106606941,LOC106601503,LOC105910937,LOC107559522 coding downstream 349235 21541433 ~ 21544389 (-)
AMCG00013143 NA coding downstream 362000 21529413 ~ 21531624 (-)
AMCG00013139 NA coding downstream 364578 21527273 ~ 21529046 (-)
AMCG00013144 NA coding upstream 19005 21924602 ~ 21935718 (-)
AMCG00013145 LOC108424875 coding upstream 118379 22023976 ~ 22039234 (-)
AMCG00013150 wdr45b,LOC107598578 coding upstream 387731 22293328 ~ 22312757 (-)
AMCG00013151 LOC108443562,LOC103039554,LOC107702472,LOC107566485,LOC107581578,LOC107722231,LOC107755515 coding upstream 414065 22319662 ~ 22367010 (-)
AMCG00013153 LOC101159951,LOC102229253,LOC101465124,LOC102212317,LOC102302210,LOC108249263,LOC107387234,LOC101071475,LOC107581637 coding upstream 465268 22370865 ~ 22375360 (-)
G42382 NA non-coding downstream 465908 21340970 ~ 21427716 (-)
G42386 NA non-coding downstream 493466 21399644 ~ 21400158 (-)
G42383 NA non-coding downstream 546790 21346475 ~ 21346834 (-)
G42372 LOC105910910,LOC103366176,LOC777984,LOC100705928 non-coding downstream 583276 21287320 ~ 21310348 (-)
G42378 LOC106596905,LOC106577420,LOC106569812 non-coding downstream 683975 21209265 ~ 21209649 (-)
G42450 NA non-coding upstream 243984 22149581 ~ 22149792 (-)
G42544 NA non-coding upstream 668961 22574558 ~ 22574827 (-)
G42553 NA non-coding upstream 800469 22706066 ~ 22706337 (-)
G42557 NA non-coding upstream 910559 22816156 ~ 22816369 (-)
G42704 NA non-coding upstream 1873328 23778925 ~ 23779350 (-)
AMCG00013133 wu:fd14a01,LOC101068441,LOC101079795,LOC103368359,LOC107721187 other downstream 366792 21503849 ~ 21526832 (-)
G42371 myhc4,LOC108412647,LOC107723326,LOC108415768,LOC105910910 other downstream 376447 21336217 ~ 21517177 (-)
AMCG00013131 LOC101068441,LOC106598369,LOC106594844,LOC106593081,LOC106593408,LOC104955241 other downstream 443670 21448329 ~ 21449954 (-)
AMCG00013137 myhm86-1,LOC107373462,LOC107574740,LOC103143810,LOC108243721,LOC106527115,LOC101079795,LOC108261476,LOC101068441,LOC101071797,LOC101163414 other downstream 471506 21411939 ~ 21422118 (-)
G42381 LOC102793686,LOC103366176,LOC105910910 other downstream 517861 21337067 ~ 21375763 (-)
AMCG00013184 prkar1a,LOC107708993,LOC106606198 other upstream 1921012 23826609 ~ 23839146 (-)
G42749 NA other upstream 1938486 23844083 ~ 23847477 (-)
AMCG00013204 mafg,LOC108241257,LOC106533856 other upstream 2974044 24879641 ~ 24902428 (-)
AMCG00013216 NA other upstream 3120141 25025738 ~ 25029004 (-)
G43001 NA other upstream 3169796 25075393 ~ 25078244 (-)

Expression


Co-expression Network