G43079 (bahcc1,LOC107722173)


Basic Information

Item Value
gene id G43079
gene name bahcc1,LOC107722173
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030125.1
NCBI id CM030125.1
chromosome length 49972098
location 25594371 ~ 25594607 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU53720
CTTGCCATCACGGTGCCGCTTCCCCATCTTGGTCTCCTCAGGGTGGTAGAACCACTTCACCTTCACCACCATGTTGCTGGCCCAGGACTCCCAGAAGCTCTCGATGCGTCCGATGTAAGGCAGGTGTGGCCGGCCGGCGGAGAGAAATACCGCGCAGTCGCCCACGCACACCGTCTCCCTGCCGCGTACTATGGCCTTGTAGAAGAGCTTGCGTGCTTTTCCCTTCATGCCCCGTCT

Function

symbol description
bahcc1 Predicted to enable chromatin binding activity.

NR:

description
PREDICTED: BAH and coiled-coil domain-containing protein 1-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU53720 True 237 lncRNA 0.61 1 25594371 25594607

Neighbor

gene id symbol gene type direction distance location
AMCG00013237 NA coding upstream 39577 25551595 ~ 25554794 (+)
AMCG00013232 NA coding upstream 108751 25479858 ~ 25485620 (+)
AMCG00013234 socs3 coding upstream 170387 25421661 ~ 25423984 (+)
AMCG00013229 NA coding upstream 209899 25375516 ~ 25384472 (+)
AMCG00013231 NA coding upstream 227825 25357317 ~ 25366546 (+)
AMCG00013243 slc38a10,LOC107749860 coding downstream 152058 25746665 ~ 25775438 (+)
AMCG00013244 LOC105892758 coding downstream 183305 25777912 ~ 25784972 (+)
AMCG00013252 ttyh2,LOC106589617,LOC106610147 coding downstream 665433 26260040 ~ 26312137 (+)
AMCG00013254 dnai2,LOC106610195 coding downstream 719679 26314286 ~ 26318743 (+)
AMCG00013253 kif19,LOC107560952 coding downstream 727159 26321766 ~ 26363091 (+)
G43078 NA non-coding upstream 2037 25588479 ~ 25592334 (+)
G43064 NA non-coding upstream 69379 25522478 ~ 25524992 (+)
G43063 NA non-coding upstream 81470 25512208 ~ 25512901 (+)
G43062 NA non-coding upstream 83024 25508191 ~ 25511347 (+)
G42950 NA non-coding upstream 218272 25089170 ~ 25376099 (+)
G43080 NA non-coding downstream 90 25594697 ~ 25595941 (+)
G43081 NA non-coding downstream 6206 25600813 ~ 25601177 (+)
G43082 NA non-coding downstream 9391 25603998 ~ 25604238 (+)
G43084 NA non-coding downstream 25003 25619610 ~ 25620005 (+)
G43085 NA non-coding downstream 26330 25620937 ~ 25621239 (+)
AMCG00013236 NA other upstream 72690 25513353 ~ 25521681 (+)
G42858 NA other upstream 824223 24768424 ~ 24770148 (+)
G42846 NA other upstream 844976 24747492 ~ 24749395 (+)
AMCG00013198 NA other upstream 1262517 24241269 ~ 24331854 (+)
AMCG00013147 NA other upstream 3333555 22248497 ~ 22260816 (+)
AMCG00013248 NA other downstream 198798 25793405 ~ 25798013 (+)
AMCG00013251 NA other downstream 558629 26153236 ~ 26161139 (+)
AMCG00013255 NA other downstream 660367 26254974 ~ 26258982 (+)
AMCG00013257 LOC106612075,LOC107560953 other downstream 773188 26367795 ~ 26396705 (+)
AMCG00013265 LOC107672452,LOC107711237,LOC107567237,LOC107670476 other downstream 833339 26427946 ~ 26478544 (+)

Expression


Co-expression Network