G44868 (map3k10,LOC107554498,LOC107560156)


Basic Information

Item Value
gene id G44868
gene name map3k10,LOC107554498,LOC107560156
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030125.1
NCBI id CM030125.1
chromosome length 49972098
location 33102639 ~ 33102873 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU55931
AGGCTGATGCGGTTGCCGTCCTTGCCCAGCTTGAGGCGGCTCTTCTTGAAGTGGCCCTTGCGCTTCTTCACCCGGGGCTTCTCCTGGTACATCTGGTGGATGATGATGTTGAGCTCTCTCTCCACAATGTCGATCTCGCGCTCTGCCAGCTCCTGCTCCCGGCGCCGTAGGACCTCCTCCTGCTCCCGCTGCTCCTCTGCCGCCCGCGCCAGGGCCTCCTCCCACGAGCGCAGCT

Function

symbol description
map3k10 Predicted to enable JUN kinase kinase kinase activity. Predicted to be involved in positive regulation of apoptotic process. Predicted to act upstream of or within protein phosphorylation. Orthologous to human MAP3K10 (mitogen-activated protein kinase kinase kinase 10).

NR:

description
PREDICTED: mitogen-activated protein kinase kinase kinase 10 isoform X2

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU55931 True 235 lncRNA 0.65 1 33102639 33102873

Neighbor

gene id symbol gene type direction distance location
AMCG00013503 ttc9b,LOC107096866,LOC103357803 coding upstream 19228 33080737 ~ 33083411 (+)
AMCG00013505 NA coding upstream 41359 33056761 ~ 33061280 (+)
AMCG00013504 NA coding upstream 57285 33032612 ~ 33045354 (+)
AMCG00013501 NA coding upstream 80839 33015315 ~ 33021800 (+)
AMCG00013502 NA coding upstream 106555 32977931 ~ 32996084 (+)
AMCG00013509 NA coding downstream 89762 33192635 ~ 33239625 (+)
AMCG00013510 NA coding downstream 169853 33272726 ~ 33284978 (+)
AMCG00013512 numbl,LOC106535595,LOC101072040,LOC106965209,LOC103154637 coding downstream 226438 33329311 ~ 33347695 (+)
AMCG00013514 NA coding downstream 349144 33452017 ~ 33464680 (+)
AMCG00013520 NA coding downstream 414282 33517155 ~ 33521234 (+)
G44867 NA non-coding upstream 1952 33100474 ~ 33100687 (+)
G44865 NA non-coding upstream 7131 33094302 ~ 33095508 (+)
G44861 NA non-coding upstream 12212 33088816 ~ 33090427 (+)
G44860 NA non-coding upstream 13879 33083728 ~ 33088760 (+)
G44790 NA non-coding upstream 264796 32837315 ~ 32837843 (+)
G44869 NA non-coding downstream 294 33103167 ~ 33103392 (+)
G44871 map3k10,LOC102787573 non-coding downstream 19147 33122020 ~ 33125449 (+)
G44954 NA non-coding downstream 336962 33439835 ~ 33441164 (+)
G44983 NA non-coding downstream 429899 33532772 ~ 33533155 (+)
G45100 NA non-coding downstream 1830333 34933206 ~ 34933787 (+)
AMCG00013478 NA other upstream 646953 32423276 ~ 32455686 (+)
AMCG00013477 ppp1r37 other upstream 702187 32393818 ~ 32400452 (+)
AMCG00013473 LOC105911162,LOC105012052,LOC107580644,LOC107566293,LOC107577119,LOC107725066 other upstream 817688 32273268 ~ 32284951 (+)
AMCG00013468 NA other upstream 1190838 31901530 ~ 31911801 (+)
G44325 NA other upstream 2325470 30776851 ~ 30777169 (+)
G44870 NA other downstream 3419 33106292 ~ 33106595 (+)
AMCG00013515 dpf1,LOC107561370,LOC107749650,LOC107672425,LOC102781105 other downstream 273647 33376520 ~ 33412841 (+)
AMCG00013516 NA other downstream 339521 33442394 ~ 33449093 (+)
G45029 NA other downstream 592719 33695592 ~ 33699545 (+)
G45072 NA other downstream 1011800 34114673 ~ 34114939 (+)

Expression


Co-expression Network