G47189



Basic Information


Item Value
gene id G47189
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information


Item Value
chromosome id CM030125.1
NCBI id CM030125.1
chromosome length 49972098
location 45283840 ~ 45284159 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence


>TU58837
CGTCCTCCCAGGAGCAGCGGTAATAGTCCTGGCCCTTGGGCGAGTCCGGGAGGTGCATGCCAGTCTCGCAGTCGAAGCCGATGCTCTGGGCCTGGCGCTGCGTGTGCCGCAGGATGGCGCCGCCCAGGTCCCGCAGGCGCACGGCGGCACGGTGGAACACGGTGTCTTTGGCGTTATACTTCAGGCAGTTGCCCACCATGAGGTTGAAGTCGGCCTCGAAGTCGGCCAGTGTGCGGTAGCCGTGGGCCTCCAGCTTGGTGCGCATGGTGGAGAAGTCCATGGGCTGGGAGATGAACTCCAGATAGTCAGGGACCTGCGGG

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU58837 True 320 lncRNA 0.65 1 45283840 45284159
Loading

Neighbor


gene id symbol gene type direction distance location
AMCG00013840 LOC104957825,LOC107725284 coding upstream 343679 44933300 ~ 44940161 (+)
AMCG00013839 NA coding upstream 364579 44901032 ~ 44919261 (+)
AMCG00013837 NA coding upstream 587069 44695779 ~ 44696771 (+)
AMCG00013834 NA coding upstream 622202 44635479 ~ 44661638 (+)
AMCG00013833 kcnd3,LOC101073956,LOC102776651,LOC102303593 coding upstream 753013 44529718 ~ 44530827 (+)
AMCG00013841 LOC101476397 coding downstream 62448 45346607 ~ 45353929 (+)
AMCG00013849 kif21b coding downstream 135754 45419913 ~ 45431617 (+)
AMCG00013848 LOC106582687 coding downstream 158927 45443086 ~ 45456185 (+)
AMCG00013851 LOC101073987,LOC107714485,LOC106582685,LOC105898132 coding downstream 206578 45490737 ~ 45494667 (+)
AMCG00013850 cpne5b,LOC107714485,LOC105027122,LOC108280970,LOC108436414 coding downstream 267814 45551973 ~ 45569316 (+)
G47188 NA non-coding upstream 240 45283392 ~ 45283600 (+)
G47186 NA non-coding upstream 2745 45279754 ~ 45281095 (+)
G47184 NA non-coding upstream 15454 45268054 ~ 45268386 (+)
G47158 NA non-coding upstream 320368 44961609 ~ 44963472 (+)
G47110 NA non-coding upstream 954293 44329293 ~ 44329547 (+)
G47190 NA non-coding downstream 2357 45286516 ~ 45286853 (+)
G47192 NA non-coding downstream 7114 45291273 ~ 45292900 (+)
G47194 NA non-coding downstream 11344 45295503 ~ 45354414 (+)
G47232 NA non-coding downstream 285250 45569409 ~ 45574313 (+)
G47255 atp5f1,LOC107679218,LOC107731279,LOC107711984 non-coding downstream 331974 45616133 ~ 45620232 (+)
AMCG00013838 si:ch211-240g9.1,LOC107598959,LOC107653411,LOC108264952,LOC108438565,LOC102786421,LOC100700110 other upstream 188171 45034772 ~ 45095669 (+)
G46945 NA other upstream 1843142 43438492 ~ 43440698 (+)
G46862 NA other upstream 2194197 43087289 ~ 43089643 (+)
G46840 LOC107711852,LOC107679810,LOC107594520,LOC108425079,LOC108265838 other upstream 2239404 43039984 ~ 43044436 (+)
AMCG00013777 NA other upstream 2621996 42650190 ~ 42661844 (+)
G47206 NA other downstream 42499 45326658 ~ 45360882 (+)
AMCG00013872 NA other downstream 532213 45816372 ~ 45823228 (+)
G47398 NA other downstream 650500 45934659 ~ 45941906 (+)
AMCG00013879 dennd2d other downstream 659412 45943571 ~ 45959194 (+)
AMCG00013919 LOC102792503,LOC106583503,LOC106565096 other downstream 1752936 47037095 ~ 47073708 (+)

Expression


G47189 Expression in all Baseline Samples

Bar chart with 16 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G47189 Expression in each Bioproject

Bar chart with 2 bars.
G47189 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 15.
End of interactive chart.

Co-expression Network