G48243



Basic Information


Item Value
gene id G48243
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information


Item Value
chromosome id CM030125.1
NCBI id CM030125.1
chromosome length 49972098
location 49068105 ~ 49112083 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence


>TU60257
taaaggaggaagtgaaacagataaagggcaaaaatagaggtatcttggaaaacgaacaagatgtggcaaatgttctaaatgagtatttcacagaggtttttacaaaagaaaaacagatgacatgccacaggttgacaatcagtccagtcaaaccctaagagagatcaggataaataaggaggaggtactaaagggactagcagaattaaaaacaaacaaatcacctgggccagatgggatatttccaacagtacttaaagaaatgagggaaattatttataggccgctaactcgattattccaaatgacacttagaacaggggatgtgccaactgac

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU60257 True 337 lncRNA 0.38 2 49068105 49112083
Loading

Neighbor


gene id symbol gene type direction distance location
AMCG00013993 NA coding upstream 111240 48939062 ~ 48956865 (+)
AMCG00013992 gnai1,LOC105897337,LOC108442115,LOC108265813,LOC100706147,LOC107590838,LOC108279833 coding upstream 155037 48908137 ~ 48913068 (+)
AMCG00013995 NA coding upstream 164075 48896802 ~ 48904030 (+)
AMCG00013988 NA coding upstream 179936 48886754 ~ 48888169 (+)
AMCG00013982 NA coding upstream 224479 48839531 ~ 48843626 (+)
AMCG00014005 LOC108246070,LOC106532244,LOC100709513 coding downstream 301872 49413955 ~ 49419897 (+)
AMCG00014004 NA coding downstream 329301 49441384 ~ 49448751 (+)
AMCG00014009 NA coding downstream 440076 49552159 ~ 49556841 (+)
AMCG00014022 NA coding downstream 452881 49564964 ~ 49569099 (+)
AMCG00014015 NA coding downstream 458118 49570201 ~ 49586822 (+)
G48236 NA non-coding upstream 17807 49027168 ~ 49050298 (+)
G48173 NA non-coding upstream 213742 48853986 ~ 48854363 (+)
G48171 NA non-coding upstream 217094 48846064 ~ 48851011 (+)
G48167 NA non-coding upstream 244492 48822701 ~ 48823613 (+)
G48155 NA non-coding upstream 272591 48791987 ~ 48795514 (+)
G48353 NA non-coding downstream 340950 49453033 ~ 49453872 (+)
G48354 NA non-coding downstream 341901 49453984 ~ 49456698 (+)
G48372 NA non-coding downstream 372406 49484489 ~ 49484959 (+)
G48449 NA non-coding downstream 567414 49679497 ~ 49679876 (+)
G48460 NA non-coding downstream 617588 49729671 ~ 49731800 (+)
AMCG00013985 NA other upstream 239130 48821250 ~ 48828975 (+)
G48150 NA other upstream 289646 48776497 ~ 48778459 (+)
G48142 NA other upstream 307393 48754953 ~ 48760712 (+)
AMCG00013971 lamtor5,xip,LOC106566397,LOC107668015 other upstream 521905 48533886 ~ 48546200 (+)
G48026 NA other upstream 716820 48281063 ~ 48351285 (+)
AMCG00013996 NA other downstream 233014 49345097 ~ 49348601 (+)
AMCG00014010 srsf3,LOC103385776,LOC105933254,LOC105017130 other downstream 425971 49538054 ~ 49545335 (+)
AMCG00014021 NA other downstream 501618 49613701 ~ 49620027 (+)
G48451 NA other downstream 577589 49689672 ~ 49692361 (+)
G48453 NA other downstream 586537 49698620 ~ 49699622 (+)

Expression


G48243 Expression in all Baseline Samples

Bar chart with 16 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 40.
End of interactive chart.

G48243 Expression in each Bioproject

Bar chart with 7 bars.
G48243 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 80.
End of interactive chart.

Co-expression Network