Fish Transcriptome and Expression Database

Home /
Search /
- Gene
- RNA
- Bioproject
Expression /
Analysis /
- Coding ability prediction
- Expression count
- Visual Omics
Tools /
- Neighbor
- BLAST
Statistics /
Download /
Help

ecological fish

G48566

Basic Information

Item	Value
gene id	G48566
gene name	NA
gene type	unknown
species	bowfin (Amia calva)
category of species	ecological fish

Chromosome Information

Item	Value
chromosome id	CM030125.1
NCBI id	CM030125.1
chromosome length	49972098
location	49913929 ~ 49914542 (+)
genome version	AmiCal1_2021_bowfin_Genome

Sequence

>TU60679
ATGCTGCTGGCGCTGCTGGTCAGAGGGCTCACCCTGCCTGGCGCTGCTGACGGGCTGCTCTTCTACCTCTCCCCAGACCCCACCCGGCTCGCCGACCCACAGGGACGCGTTCGGGCTGTGCCTGCTCAACAGCACCACCAGCCTGCTGTTCGGGGTGGCCATCTTCTCCGTGCTTGGCTTCATGGAACGGAACGGAATCTGGAGGTCAGCGAGGTGGCGCAGGCAGG

Function

GO: NA

KEGG:

id	description
ko04110	Cell cycle

RNA

RNA id	representative	length	rna type	GC content	exon number	start site	end site
TU60679	True	227	TUCP	0.67	2	49913929	49914542

Notice the +/- strand.
Display format: symbol/gene id: RNA id. (Except when gene id is similar to RNA id.)
You can browse transcripts by dragging.
A more detailed transcript can be viewed by the zoom button in the upper right corner.

Neighbor

gene id	symbol	gene type	direction	distance	location
AMCG00014040	NA	coding	upstream	71614	49837425 ~ 49842315 (+)
AMCG00014031	NA	coding	upstream	141145	49772161 ~ 49772784 (+)
AMCG00014037	NA	coding	upstream	142035	49770593 ~ 49771894 (+)
AMCG00014030	NA	coding	upstream	175770	49736414 ~ 49738159 (+)
AMCG00014029	usp49,LOC106583088	coding	upstream	184937	49717514 ~ 49728992 (+)
AMCG00014039	NA	coding	downstream	4085	49918627 ~ 49925703 (+)
AMCG00014049	NA	coding	downstream	12684	49927226 ~ 49929020 (+)
G48560	tmcc2,LOC106565656	non-coding	upstream	40552	49871106 ~ 49873377 (+)
G48552	NA	non-coding	upstream	56242	49857480 ~ 49857687 (+)
G48479	NA	non-coding	upstream	120279	49793206 ~ 49793650 (+)
G48467	NA	non-coding	upstream	159902	49753584 ~ 49754027 (+)
G48460	NA	non-coding	upstream	182129	49729671 ~ 49731800 (+)
AMCG00014038	NA	other	upstream	99944	49808148 ~ 49813985 (+)
AMCG00014028	NA	other	upstream	164760	49739312 ~ 49749169 (+)
G48464	NA	other	upstream	171415	49741852 ~ 49742514 (+)
G48457	NA	other	upstream	190053	49723026 ~ 49723876 (+)
AMCG00014032	usp49	other	upstream	196501	49706843 ~ 49717428 (+)
G48578	NA	other	downstream	22273	49936815 ~ 49948082 (+)
G48583	NA	other	downstream	41650	49956192 ~ 49956729 (+)

Expression

Co-expression Network