AMCG00014118



Basic Information


Item Value
gene id AMCG00014118
gene name NA
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information


Item Value
chromosome id CM030128.1
NCBI id CM030128.1
chromosome length 42883965
location 2151885 ~ 2154746 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence


>AMCG00014118
ATGATCCTTCTGTCAGTATTGCGTATCTCCAGTTCAGCAGGAAGAGCCAAGGCCGTGTCCACCTGCAGCTCACACCTGCTGGTCATCTCTGTGTTCTTCCTCACAATAGCAGGGGTCTTCATCTCCTACAGGATTCCTGGGACCTCCGTGGACATGCGTGTCATGGGGTCTGTGATTCAGAATGTCTTCCCTGCCCTCATGAATCCGATCATCTACTGCCTGAGGACTAAAGAGATCAGGGACAGCTTGATTAATACCCTAAAAAAGACCAAAATCTTCCCAGGTAGCAAGTGA

Function


GO:

id name namespace
GO:0050896 response to stimulus biological_process
GO:0016020 membrane cellular_component
GO:0004871 obsolete signal transducer activity molecular_function

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
AMCG00014118 True 294 mRNA 0.50 2 2151885 2154746

Neighbor


gene id symbol gene type direction distance location
AMCG00014116 NA coding downstream 105638 2038470 ~ 2046247 (-)
AMCG00014114 son,LOC107709257,LOC107698212 coding downstream 114064 2032712 ~ 2037821 (-)
AMCG00014117 NA coding downstream 119456 2032241 ~ 2032429 (-)
AMCG00014115 son,LOC565999,LOC107698912,LOC107555269,LOC107709257,LOC107698212 coding downstream 120358 2029590 ~ 2031527 (-)
AMCG00014110 NA coding downstream 236295 1906150 ~ 1915590 (-)
AMCG00014133 NA coding upstream 22073 2176819 ~ 2177304 (-)
AMCG00014136 NA coding upstream 113771 2268517 ~ 2278983 (-)
AMCG00014138 NA coding upstream 170356 2325102 ~ 2339187 (-)
AMCG00014132 NA coding upstream 388172 2542918 ~ 2548184 (-)
AMCG00014131 NA coding upstream 407787 2562533 ~ 2570391 (-)
G67881 NA non-coding downstream 92394 2056849 ~ 2059491 (-)
G67849 NA non-coding downstream 209465 1942027 ~ 1942420 (-)
G67818 NA non-coding downstream 330126 1820612 ~ 1821759 (-)
G67691 NA non-coding downstream 1053906 1097656 ~ 1097979 (-)
G67686 NA non-coding downstream 1280258 871053 ~ 871627 (-)
G67911 NA non-coding upstream 195379 2350125 ~ 2373329 (-)
G67953 NA non-coding upstream 453523 2608269 ~ 2608479 (-)
G68057 NA non-coding upstream 542062 2696808 ~ 2701159 (-)
G68061 NA non-coding upstream 553071 2707817 ~ 2710329 (-)
G68070 NA non-coding upstream 603739 2758485 ~ 2758840 (-)
AMCG00014119 NA other downstream 26932 2085941 ~ 2124953 (-)
G67843 NA other downstream 233703 1916727 ~ 1918182 (-)
G67832 NA other downstream 249270 1900640 ~ 1902615 (-)
G67835 NA other downstream 259332 1892063 ~ 1892553 (-)
AMCG00014108 NA other downstream 266453 1879203 ~ 1885432 (-)
AMCG00014134 NA other upstream 377208 2531954 ~ 2542697 (-)
AMCG00014144 NA other upstream 486313 2641059 ~ 2653247 (-)
G68088 NA other upstream 670816 2825562 ~ 2829144 (-)
AMCG00014181 ppef1,LOC105893339,LOC108425737,LOC107695075 other upstream 1231011 3385757 ~ 3394754 (-)
AMCG00014228 NA other upstream 3504326 5659072 ~ 5678499 (-)

Expression



Co-expression Network