AMCG00014129



Basic Information


Item Value
gene id AMCG00014129
gene name NA
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information


Item Value
chromosome id CM030128.1
NCBI id CM030128.1
chromosome length 42883965
location 2400418 ~ 2401353 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence


>AMCG00014129
ATGATCCTTCTGTCAGTATTGCGCATCTCCAGTTCAGGGGGAAGAGCCAAGGCCGTTTCCACCTGCAGCTCACACTTGCTGGTCATCTCTGTGTTCTTCCTCACGACAGCAGGGGTCTTCATCTCCTACAGGATTCCTGGGACCTCAGTGGACATGCGTGTTATGGGGTCTGTGATTCAGAATGTCTTCCCCGCTCTCATGAATCCAATTATCTATTGCCTGAGAACTAAAGAGATCAGGGACAGCTTGGCGAAAACCCTGAAGAAGAGCAGTGTCTTTCCAGGTAGGAAGTGA

Function


GO:

id name namespace
GO:0050896 response to stimulus biological_process
GO:0016020 membrane cellular_component
GO:0004871 obsolete signal transducer activity molecular_function

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
AMCG00014129 True 294 mRNA 0.50 2 2400418 2401353

Neighbor


gene id symbol gene type direction distance location
AMCG00014139 NA coding upstream 11206 2378234 ~ 2389212 (+)
AMCG00014125 NA coding upstream 75028 2276709 ~ 2325390 (+)
AMCG00014121 NA coding upstream 147130 2239638 ~ 2253288 (+)
AMCG00014123 NA coding upstream 177514 2221615 ~ 2222904 (+)
AMCG00014122 NA coding upstream 204845 2179646 ~ 2195573 (+)
AMCG00014127 NA coding downstream 13209 2414562 ~ 2422277 (+)
AMCG00014140 NA coding downstream 33464 2434817 ~ 2438719 (+)
AMCG00014135 NA coding downstream 49696 2451049 ~ 2454556 (+)
AMCG00014137 NA coding downstream 85272 2486625 ~ 2497147 (+)
AMCG00014128 NA coding downstream 138350 2539703 ~ 2542398 (+)
G67908 NA non-coding upstream 27113 2350129 ~ 2373305 (+)
G67907 NA non-coding upstream 66474 2333491 ~ 2333944 (+)
G67899 NA non-coding upstream 251764 2148449 ~ 2148654 (+)
G67882 NA non-coding upstream 322816 2077303 ~ 2077602 (+)
G67789 NA non-coding upstream 557973 1840165 ~ 1842445 (+)
G67983 NA non-coding downstream 344891 2746244 ~ 2755484 (+)
G67988 NA non-coding downstream 366149 2767502 ~ 2768837 (+)
G67994 NA non-coding downstream 380986 2782339 ~ 2802044 (+)
G67997 NA non-coding downstream 391389 2792742 ~ 2797809 (+)
G68046 NA non-coding downstream 574861 2976214 ~ 2976510 (+)
G67896 NA other upstream 270273 2126872 ~ 2130145 (+)
AMCG00014111 NA other upstream 497731 1900220 ~ 1902687 (+)
G67801 NA other upstream 519377 1879091 ~ 1881041 (+)
AMCG00014104 cyyr1,LOC107751099 other upstream 562293 1835432 ~ 1838125 (+)
AMCG00014099 NA other upstream 902814 1479919 ~ 1497604 (+)
AMCG00014146 NA other downstream 305487 2706840 ~ 2710329 (+)
AMCG00014196 NA other downstream 1726123 4127476 ~ 4131718 (+)
G68475 NA other downstream 2247847 4649200 ~ 4651964 (+)
G68830 NA other downstream 4944842 7346195 ~ 7349467 (+)
G68848 NA other downstream 5012287 7413640 ~ 7416594 (+)

Expression



Co-expression Network