AMCG00014736 (cryaa)


Basic Information

Item Value
gene id AMCG00014736
gene name cryaa
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030128.1
NCBI id CM030128.1
chromosome length 42883965
location 29431521 ~ 29437107 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00014736
ATGGATATTGCCATCCAGCACCCCTGGTTTAGACGGGCCCTGGGCTCCCTCTACCCCAGCCGTCTCTTTGACCAGTTTTTCGGGGAAGGGCTGTTCGAGTACGACCTCTTTCCCTATGCCACCTCTACCATCAGCCCTTTCTACAGACAGACCCTCTTCCGCAACTTCATGGAATCGACCAATTCCGGCATCTCTGAGGTGCGGTCTGAAAGGGACAAGTTCACAATCTTCCTGGATGTCAAACACTTCTCCCCTGACGAGCTGAACGTGAAGGTTATGGATGACTATGTGGAAATTCAAGGCAAGCATGGAGAGAGACAGGACGACCATGGCTACATTTCCCGCGAGTTCCAACGCCGCTACCGCCTGCCCTCCAACGTGGATCAGTCGGCTATCACCTGCTCGCTGTCCTCTGATGGGCTCCTGACCCTCTGTGGCCCCAAGACGTCCACAGGCACAGACTCCAGCCGCGGCGACCGGAACATCCCCGTGACCCGCGAGGAGAAGCCCACTTCCGCCGCATCCTCTTAG

Function

symbol description
cryaa Enables unfolded protein binding activity. Acts upstream of or within lens development in camera-type eye. Is expressed in eye; lens; and solid lens vesicle. Used to study cataract. Human ortholog(s) of this gene implicated in cataract 9 multiple types. Orthologous to human CRYAA (crystallin alpha A).

NR:

description
PREDICTED: alpha-crystallin A chain

GO:

id name namespace
GO:0001654 eye development biological_process
GO:0046872 metal ion binding molecular_function
GO:0005212 structural constituent of eye lens molecular_function
GO:0051082 unfolded protein binding molecular_function

KEGG:

id description
K09541 CRYAA; crystallin, alpha A

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00014736 True 531 mRNA 0.57 3 29431521 29437107

Neighbor

gene id symbol gene type direction distance location
AMCG00014740 LOC107557921 coding upstream 10142 29400632 ~ 29421379 (+)
AMCG00014741 LOC106586690,LOC106582147,LOC106575755 coding upstream 33300 29383488 ~ 29398221 (+)
AMCG00014737 NA coding upstream 109929 29307940 ~ 29321592 (+)
AMCG00014733 NA coding upstream 302479 29120951 ~ 29129042 (+)
AMCG00014734 NA coding upstream 320883 29096129 ~ 29110638 (+)
AMCG00014743 NA coding downstream 103424 29540531 ~ 29558701 (+)
AMCG00014746 rev1 coding downstream 151694 29588801 ~ 29614037 (+)
AMCG00014745 txndc9,LOC107568936,LOC107668903,LOC106586783 coding downstream 206669 29643776 ~ 29649810 (+)
AMCG00014747 NA coding downstream 216086 29653193 ~ 29657089 (+)
AMCG00014753 NA coding downstream 222437 29659544 ~ 29684659 (+)
G72426 NA non-coding upstream 239243 29191971 ~ 29192278 (+)
G72415 NA non-coding upstream 271096 29157025 ~ 29160425 (+)
G72409 NA non-coding upstream 294168 29137129 ~ 29137353 (+)
G72354 NA non-coding upstream 440222 28989607 ~ 28991299 (+)
G72353 NA non-coding upstream 445945 28981122 ~ 28985576 (+)
G72767 NA non-coding downstream 1399729 30836836 ~ 30837169 (+)
G72768 NA non-coding downstream 1404453 30841560 ~ 30844670 (+)
G72769 NA non-coding downstream 1409055 30846162 ~ 30846421 (+)
G72783 NA non-coding downstream 1518798 30955905 ~ 30956284 (+)
G72789 NA non-coding downstream 1566265 31003372 ~ 31003788 (+)
AMCG00014738 NA other upstream 152372 29268329 ~ 29279149 (+)
AMCG00014739 NA other upstream 175167 29247875 ~ 29256354 (+)
AMCG00014729 NA other upstream 593611 28797049 ~ 28837910 (+)
G72175 LOC102776245 other upstream 1127448 28302373 ~ 28304073 (+)
AMCG00014703 ndp,LOC107565935,LOC106586792 other upstream 1551721 27868703 ~ 27879800 (+)
AMCG00014757 LOC105927538,LOC107688735,LOC105016589,LOC104946938,LOC107716767,LOC107676512,LOC107099897,LOC103140352 other downstream 406360 29843467 ~ 29846586 (+)
G72605 NA other downstream 414343 29851450 ~ 29851821 (+)
AMCG00014777 NA other downstream 1327244 30764351 ~ 30812287 (+)
G72785 fam160a2 other downstream 1541109 30978216 ~ 30978825 (+)
G72786 NA other downstream 1542463 30979570 ~ 30980252 (+)

Expression


Co-expression Network