AMCG00014823 (slc10a2)


Basic Information

Item Value
gene id AMCG00014823
gene name slc10a2
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030128.1
NCBI id CM030128.1
chromosome length 42883965
location 32791881 ~ 32793425 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00014823
ATGACTTATCCGAACTGTTCGGCTAATGCCACTGTTTGCAGTGGCACGTCTTGCCTGGAGCCTTCAAGCAACGCTAACGAGATTCTGAGTCTGGTTCTAAGCACGGTGTTGACAGTAATGCTGGCAATAGTGATGTTCTCCATGGGCTGTACAGTAGAGGCAAGAAAACTGTGGGGACACATCAAGAGGCCTTGGGGAATTTTCATCGGCTTTCTCTGTCAGTTCGGTATCATGCCAATGGTGGCGTTTCTGTTGTCTCTCGCCTTCCAAGTACAGCCCATTCAGGCAGTAGCGATCTTGGTCATGGGCTGCTGTCCTGGGGGTTCTGGGTCCAATATTTTAGCCTACTGGTTAGATGGGGACATGGACCTCAGCATAAGCATGACCGCCTGTTCCTCGATTCTGGCAATGGGAATGATGCCATTGTGCCTTCTCATCTACACCACAATGTGGACCTCAACTAGCGCCGTCCAGATACCTTACGACAGCATTGGTAAGACGTGTTAA

Function

symbol description
slc10a2 Predicted to enable bile acid:sodium symporter activity. Acts upstream of or within organic hydroxy compound transport. Predicted to be located in membrane. Predicted to be integral component of membrane. Predicted to be active in apical plasma membrane. Is expressed in cloaca; gut; and intestine. Human ortholog(s) of this gene implicated in intestinal disease. Orthologous to human SLC10A2 (solute carrier family 10 member 2).

NR:

description
ileal sodium/bile acid cotransporter

GO:

id name namespace
GO:0015721 bile acid and bile salt transport biological_process
GO:0035725 sodium ion transmembrane transport biological_process
GO:0006869 lipid transport biological_process
GO:0016021 integral component of membrane cellular_component
GO:0008508 bile acid molecular_function

KEGG:

id description
K03453 TC.BASS; bile acid:Na+ symporter, BASS family

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00014823 True 507 mRNA 0.50 2 32791881 32793425

Neighbor

gene id symbol gene type direction distance location
AMCG00014818 NA coding downstream 138461 32650176 ~ 32653420 (-)
AMCG00014819 NA coding downstream 142886 32647534 ~ 32648995 (-)
AMCG00014820 NA coding downstream 149949 32628832 ~ 32641932 (-)
AMCG00014814 NA coding downstream 469122 32321974 ~ 32322759 (-)
AMCG00014813 NA coding downstream 505945 32270685 ~ 32285936 (-)
AMCG00014826 NA coding upstream 334253 33127678 ~ 33434382 (-)
AMCG00014828 NA coding upstream 1771061 34564486 ~ 34565202 (-)
AMCG00014829 efnb2a coding upstream 2117168 34910593 ~ 34931646 (-)
AMCG00014830 arglu1,LOC106586866 coding upstream 2149550 34942975 ~ 34960249 (-)
AMCG00014832 NA coding upstream 2379444 35172869 ~ 35180639 (-)
G73187 NA non-coding downstream 1483 32789023 ~ 32790398 (-)
G73184 NA non-coding downstream 80178 32711247 ~ 32711703 (-)
G73183 NA non-coding downstream 80836 32710797 ~ 32711045 (-)
G73182 NA non-coding downstream 81766 32709844 ~ 32710115 (-)
G73181 NA non-coding downstream 83598 32708013 ~ 32708283 (-)
G73232 NA non-coding upstream 453912 33247337 ~ 33247621 (-)
G73242 NA non-coding upstream 526000 33319425 ~ 33319625 (-)
G73245 NA non-coding upstream 572283 33365708 ~ 33366083 (-)
G73259 NA non-coding upstream 852508 33645933 ~ 33702805 (-)
G73260 NA non-coding upstream 985568 33778993 ~ 33779193 (-)
G73127 NA other downstream 172732 32597462 ~ 32619149 (-)
AMCG00014816 NA other downstream 235936 32455306 ~ 32555945 (-)
G73047 NA other downstream 528454 32263167 ~ 32263427 (-)
AMCG00014775 NA other downstream 1945081 30841523 ~ 30846800 (-)
G72477 LOC106598269,LOC101158751,LOC106586690,LOC103361283 other downstream 3393576 29389290 ~ 29398305 (-)
AMCG00014824 NA other upstream 1580 32795005 ~ 32806295 (-)
AMCG00014825 NA other upstream 276824 33070249 ~ 33119328 (-)
G73328 LOC101154678 other upstream 1976158 34769583 ~ 34769979 (-)
AMCG00014839 tmem50b,LOC101064157,LOC101067980 other upstream 2787201 35580626 ~ 35608677 (-)
G73604 pdxk,LOC106574311,LOC105019670,LOC108428208,LOC107676865 other upstream 3307933 36101358 ~ 36182351 (-)

Expression


Co-expression Network