AMCG00014851 (rac2,LOC107561353,LOC105892187,LOC108436672,LOC106522484)


Basic Information

Item Value
gene id AMCG00014851
gene name rac2,LOC107561353,LOC105892187,LOC108436672,LOC106522484
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030128.1
NCBI id CM030128.1
chromosome length 42883965
location 36931007 ~ 36944739 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00014851
ATGATTACCAACAGTAGGGAAGTGGTTAAAAGTGAGGATGTGTTCCTTATCTGCTTCTCCCTGGTGAGCCCGGCATCTTATGAGAATGTTAGAGCTAAGTGGTACCCAGAGGTTCGCCACCACTGCCCTTCCACCCCCATCATTCTGGTGGGAACCAAGCTGGATCTGAGGGATGAGAAGGACACCATCGAGAAGCTGAAGGAGAAGAAGCTGGCTCCCATCACCTATCCTCAAGGCCTAGCTCTTGCCAAAGAAATAGATGCCGTGAAGTACCTGGAGTGCTCTGCCTTGACTCAGAGAGGCCTAAAGACTGTGTTCGATGAAGCCATCCGTGCTGTGCTGTGCCCACAGCCCACCAAGGTCAAGAAACGAGGATGCCAACTCCTGTGA

Function

symbol description
rac2 Predicted to enable GTP binding activity; GTPase activity; and protein kinase binding activity. Acts upstream of or within several processes, including defense response to other organism; leukocyte chemotaxis; and regulation of neutrophil migration. Located in cytoplasm. Is expressed in neutrophil and thymus. Human ortholog(s) of this gene implicated in immunodeficiency 73a with defective neutrophil chemotaxis and leukocytosis; immunodeficiency 73b with defective neutrophil chemotaxis and lymphopenia; and immunodeficiency 73c with defective neutrophil chemotaxis and hypogammaglobulinemia. Orthologous to human RAC2 (Rac family small GTPase 2).

NR:

description
ras-related C3 botulinum toxin substrate 2 (rho family, small GTP binding protein Rac2)

GO:

id name namespace
GO:0032878 regulation of establishment or maintenance of cell polarity biological_process
GO:0001780 neutrophil homeostasis biological_process
GO:0007264 small GTPase mediated signal transduction biological_process
GO:0009611 response to wounding biological_process
GO:0002446 neutrophil mediated immunity biological_process
GO:2000391 positive regulation of neutrophil extravasation biological_process
GO:0016020 membrane cellular_component
GO:0005737 cytoplasm cellular_component
GO:0005525 GTP binding molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00014851 True 390 mRNA 0.52 4 36931007 36944739

Neighbor

gene id symbol gene type direction distance location
AMCG00014849 NA coding downstream 126168 36803232 ~ 36804839 (-)
AMCG00014846 LOC107578620 coding downstream 360699 36539818 ~ 36570308 (-)
AMCG00014847 NA coding downstream 404197 36464454 ~ 36526810 (-)
AMCG00014844 NA coding downstream 598526 36173845 ~ 36332481 (-)
AMCG00014843 NA coding downstream 857699 36062619 ~ 36073308 (-)
AMCG00014855 NA coding upstream 99471 37044210 ~ 37047479 (-)
AMCG00014856 NA coding upstream 124132 37068871 ~ 37073768 (-)
AMCG00014854 NA coding upstream 135418 37080157 ~ 37115666 (-)
AMCG00014858 NA coding upstream 357485 37302224 ~ 37309817 (-)
AMCG00014857 LOC108412080,LOC108430011 coding upstream 379003 37323742 ~ 37359709 (-)
G73722 NA non-coding downstream 200446 36689357 ~ 36730561 (-)
G73704 NA non-coding downstream 278964 36646059 ~ 36652043 (-)
G73667 NA non-coding downstream 455059 36474243 ~ 36475948 (-)
G73609 NA non-coding downstream 736757 36194048 ~ 36194250 (-)
G73606 NA non-coding downstream 873549 36055996 ~ 36057458 (-)
G73776 NA non-coding upstream 71211 37015950 ~ 37016173 (-)
G73803 NA non-coding upstream 228191 37172930 ~ 37173171 (-)
G73851 NA non-coding upstream 573304 37518043 ~ 37518331 (-)
G73853 NA non-coding upstream 586731 37531470 ~ 37531976 (-)
G73857 NA non-coding upstream 628999 37573738 ~ 37574140 (-)
AMCG00014845 NA other downstream 537514 36373151 ~ 36393493 (-)
G73612 NA other downstream 676820 36253774 ~ 36254187 (-)
G73604 pdxk,LOC106574311,LOC105019670,LOC108428208,LOC107676865 other downstream 748656 36101358 ~ 36182351 (-)
AMCG00014839 tmem50b,LOC101064157,LOC101067980 other downstream 1322330 35580626 ~ 35608677 (-)
G73328 LOC101154678 other downstream 2161028 34769583 ~ 34769979 (-)
G73833 NA other upstream 380281 37325020 ~ 37325307 (-)
G73916 NA other upstream 834594 37779333 ~ 37783575 (-)
AMCG00014865 NA other upstream 857355 37802094 ~ 37864483 (-)
G74087 NA other upstream 1398583 38343322 ~ 38350291 (-)
G74107 NA other upstream 1467421 38412160 ~ 38413231 (-)

Expression


Co-expression Network