G68474


Basic Information

Item Value
gene id G68474
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030128.1
NCBI id CM030128.1
chromosome length 42883965
location 4647702 ~ 4648211 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU85564
ggcccgtgtggtccgatccaacagacgagctactgtagctcaaattgctgaaaaagtgaatgctggttctgatagaaaggtgtcagaacacacagtgcatcgcagtttgttgcgtatggggctgcgtagccgcagaccagtcagggtgcccatgctgacccctgtccactgccgaaagcgcctacaatgggcacgtgagcatcagaactggaccacggagcaatggaagaaggtggcctggtctgatgaatcacgagttcaaggtgttgacttggcctccaaataggccccacttcgcaacttacaggacttaaaggatctgctgctaacgtcttggtgccagataccacagcacaccttcagaggtctagtggagtccatgcctcgacgggtcagggctgttttggcggcaaaagggggacctacacaatattaggcaggtggtc

Function

GO: NA

KEGG:

id description
ko04974 Protein digestion and absorption

RNA

RNA id representative length rna type GC content exon number start site end site
TU85564 True 446 lncRNA 0.54 2 4647702 4648211

Neighbor

gene id symbol gene type direction distance location
AMCG00014212 tbl1x,LOC106582098,LOC102307724,LOC101465000,LOC102798223 coding downstream 41741 4588397 ~ 4605961 (-)
AMCG00014211 NA coding downstream 81758 4560163 ~ 4565944 (-)
AMCG00014210 NA coding downstream 127303 4511821 ~ 4520399 (-)
AMCG00014204 NA coding downstream 258509 4384145 ~ 4389193 (-)
AMCG00014206 gemin8 coding downstream 264857 4382603 ~ 4382845 (-)
AMCG00014215 NA coding upstream 211046 4859257 ~ 4864318 (-)
AMCG00014227 NA coding upstream 996641 5644852 ~ 5655578 (-)
AMCG00014226 NA coding upstream 1031005 5679216 ~ 5698927 (-)
AMCG00014231 NA coding upstream 1178548 5826759 ~ 5843215 (-)
AMCG00014230 NA coding upstream 1198077 5846288 ~ 5850922 (-)
G68406 NA non-coding downstream 230768 4416656 ~ 4416934 (-)
G68386 NA non-coding downstream 348018 4298305 ~ 4299684 (-)
G68336 NA non-coding downstream 517961 4105518 ~ 4129741 (-)
G68325 NA non-coding downstream 547775 4099564 ~ 4099927 (-)
G68324 prps2,LOC108413289 non-coding downstream 549227 4096215 ~ 4098475 (-)
G68514 NA non-coding upstream 237714 4885925 ~ 4886283 (-)
G68535 NA non-coding upstream 685881 5334092 ~ 5334383 (-)
G68537 NA non-coding upstream 749617 5397828 ~ 5398235 (-)
G68547 NA non-coding upstream 939288 5587499 ~ 5587992 (-)
G68572 NA non-coding upstream 1009094 5657305 ~ 5703927 (-)
AMCG00014181 ppef1,LOC105893339,LOC108425737,LOC107695075 other downstream 1252948 3385757 ~ 3394754 (-)
G68088 NA other downstream 1818558 2825562 ~ 2829144 (-)
AMCG00014144 NA other downstream 1994455 2641059 ~ 2653247 (-)
AMCG00014134 NA other downstream 2105005 2531954 ~ 2542697 (-)
AMCG00014119 NA other downstream 2522749 2085941 ~ 2124953 (-)
AMCG00014228 NA other upstream 1010861 5659072 ~ 5678499 (-)
AMCG00014241 NA other upstream 1411278 6059489 ~ 6108358 (-)
AMCG00014271 NA other upstream 2729877 7378088 ~ 7386984 (-)
AMCG00014276 LOC106575771,LOC106574874,LOC107705522,LOC107584803,LOC105911816,LOC105019730 other upstream 2753941 7402152 ~ 7411890 (-)
AMCG00014278 NA other upstream 2765518 7413729 ~ 7423291 (-)

Expression


Co-expression Network