G68535


Basic Information

Item Value
gene id G68535
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030128.1
NCBI id CM030128.1
chromosome length 42883965
location 5334092 ~ 5334383 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU85633
attgagaacaagggcagtgatgttcagactgtacaatgcactagttagagctcatctggatactgtggacagttctgggctccacacttcaagaaagatatcgctgctctagaggcagttcagaggagagcaaccagacttattccaggtctgaagggaaagtcctactgagagactgagggacctgaaccttttcaccctggaacagaggagactacgtggggacttgatccaagtcttcaaaatcatgaaaggcatcgaccacatcaaaccagaggagcttttccagatc

Function

GO: NA

KEGG:

id description
ko04064 NF-kappa B signaling pathway
ko04640 Hematopoietic cell lineage
ko04660 T cell receptor signaling pathway
ko04658 Th1 and Th2 cell differentiation
ko04659 Th17 cell differentiation
ko05340 Primary immunodeficiency

RNA

RNA id representative length rna type GC content exon number start site end site
TU85633 True 292 lncRNA 0.48 1 5334092 5334383

Neighbor

gene id symbol gene type direction distance location
AMCG00014215 NA coding downstream 469774 4859257 ~ 4864318 (-)
AMCG00014212 tbl1x,LOC106582098,LOC102307724,LOC101465000,LOC102798223 coding downstream 728131 4588397 ~ 4605961 (-)
AMCG00014211 NA coding downstream 768148 4560163 ~ 4565944 (-)
AMCG00014210 NA coding downstream 813693 4511821 ~ 4520399 (-)
AMCG00014204 NA coding downstream 944899 4384145 ~ 4389193 (-)
AMCG00014227 NA coding upstream 310469 5644852 ~ 5655578 (-)
AMCG00014226 NA coding upstream 344833 5679216 ~ 5698927 (-)
AMCG00014231 NA coding upstream 492376 5826759 ~ 5843215 (-)
AMCG00014230 NA coding upstream 511905 5846288 ~ 5850922 (-)
AMCG00014232 NA coding upstream 529973 5864356 ~ 5866524 (-)
G68514 NA non-coding downstream 447809 4885925 ~ 4886283 (-)
G68474 NA non-coding downstream 685881 4647702 ~ 4648211 (-)
G68406 NA non-coding downstream 917158 4416656 ~ 4416934 (-)
G68386 NA non-coding downstream 1034408 4298305 ~ 4299684 (-)
G68336 NA non-coding downstream 1204351 4105518 ~ 4129741 (-)
G68537 NA non-coding upstream 63445 5397828 ~ 5398235 (-)
G68547 NA non-coding upstream 253116 5587499 ~ 5587992 (-)
G68572 NA non-coding upstream 322922 5657305 ~ 5703927 (-)
G68581 NA non-coding upstream 375435 5709818 ~ 5710080 (-)
G68590 NA non-coding upstream 445102 5779485 ~ 5782392 (-)
AMCG00014181 ppef1,LOC105893339,LOC108425737,LOC107695075 other downstream 1939338 3385757 ~ 3394754 (-)
G68088 NA other downstream 2504948 2825562 ~ 2829144 (-)
AMCG00014144 NA other downstream 2680845 2641059 ~ 2653247 (-)
AMCG00014134 NA other downstream 2791395 2531954 ~ 2542697 (-)
AMCG00014119 NA other downstream 3209139 2085941 ~ 2124953 (-)
AMCG00014228 NA other upstream 324689 5659072 ~ 5678499 (-)
AMCG00014241 NA other upstream 725106 6059489 ~ 6108358 (-)
AMCG00014271 NA other upstream 2043705 7378088 ~ 7386984 (-)
AMCG00014276 LOC106575771,LOC106574874,LOC107705522,LOC107584803,LOC105911816,LOC105019730 other upstream 2067769 7402152 ~ 7411890 (-)
AMCG00014278 NA other upstream 2079346 7413729 ~ 7423291 (-)

Expression


Co-expression Network