G68905


Basic Information

Item Value
gene id G68905
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030128.1
NCBI id CM030128.1
chromosome length 42883965
location 7625985 ~ 7626375 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU86117
ccctgctgattttgtacgtttgcccactgacaaagaaatgatcagtctataattttaatggtaggtgtattttaacagtgagagacagaataacaacaacaaaatccagaaaaacgcatttcaaaaaagttatacattgatttgcatgttaatgagggaaataagtatttgaccccttcgacttagtacttggtggcaaaacccttgttggcaatcacagaggtcagacgtttcttgtagttggccaccaggtttgcacacatctcaggagggattttgtcccactcctctttgcagatcctctccaagtcattaaggtttcgaggctgacgtttggcaactcgaaccttcagctccctccacagattctctatgggattaaggtctggag

Function

GO: NA

KEGG:

id description
ko04610 Complement and coagulation cascades

RNA

RNA id representative length rna type GC content exon number start site end site
TU86117 True 391 lncRNA 0.42 1 7625985 7626375

Neighbor

gene id symbol gene type direction distance location
AMCG00014280 NA coding downstream 45885 7569311 ~ 7580100 (-)
AMCG00014275 NA coding downstream 189879 7426221 ~ 7436106 (-)
AMCG00014279 NA coding downstream 200309 7425128 ~ 7425676 (-)
AMCG00014277 NA coding downstream 228216 7387618 ~ 7397769 (-)
AMCG00014270 LOC102779158 coding downstream 249062 7367394 ~ 7376923 (-)
AMCG00014284 NA coding upstream 42178 7668553 ~ 7675258 (-)
AMCG00014287 NA coding upstream 104639 7731014 ~ 7751865 (-)
AMCG00014286 NA coding upstream 126531 7752906 ~ 7783002 (-)
AMCG00014291 LOC107586940 coding upstream 394610 8020985 ~ 8060018 (-)
AMCG00014296 NA coding upstream 515814 8142189 ~ 8147008 (-)
G68875 NA non-coding downstream 160323 7465409 ~ 7465662 (-)
G68874 NA non-coding downstream 166096 7455978 ~ 7459889 (-)
G68867 NA non-coding downstream 184813 7440500 ~ 7441172 (-)
G68829 NA non-coding downstream 285430 7340351 ~ 7340555 (-)
G68827 NA non-coding downstream 336548 7288936 ~ 7289437 (-)
G68981 NA non-coding upstream 247778 7874153 ~ 7874358 (-)
G69086 NA non-coding upstream 600119 8226494 ~ 8250561 (-)
G69233 NA non-coding upstream 1264181 8890556 ~ 8890839 (-)
G69250 NA non-coding upstream 1372051 8998426 ~ 8998626 (-)
G69352 dcaf6 non-coding upstream 1723413 9349788 ~ 9355238 (-)
AMCG00014278 NA other downstream 202694 7413729 ~ 7423291 (-)
AMCG00014276 LOC106575771,LOC106574874,LOC107705522,LOC107584803,LOC105911816,LOC105019730 other downstream 214095 7402152 ~ 7411890 (-)
AMCG00014271 NA other downstream 239001 7378088 ~ 7386984 (-)
AMCG00014241 NA other downstream 1517627 6059489 ~ 6108358 (-)
AMCG00014228 NA other downstream 1947486 5659072 ~ 5678499 (-)
AMCG00014297 NA other upstream 508528 8134903 ~ 8139126 (-)
AMCG00014298 NA other upstream 529557 8155932 ~ 8158590 (-)
G69156 LOC107673457,LOC105895139,LOC107711008,LOC106521848,LOC107716961,LOC101064050,LOC103356925 other upstream 756910 8383285 ~ 8384224 (-)
AMCG00014328 mpc2,LOC107673680,LOC107695492 other upstream 1678864 9305239 ~ 9317167 (-)
AMCG00014340 NA other upstream 2374759 10001134 ~ 10017751 (-)

Expression


Co-expression Network