G71726 (rap2a,LOC106512668,LOC106582448,LOC100695037,LOC103391592)


Basic Information

Item Value
gene id G71726
gene name rap2a,LOC106512668,LOC106582448,LOC100695037,LOC103391592
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030128.1
NCBI id CM030128.1
chromosome length 42883965
location 25508597 ~ 25508870 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU89673
TTTCACCCTGATGATCTGATCCCTCATTGGTTTAATGTCCTGGAAGCTCTGCTGGTTCACAAGGCTGTAGACCAAGATGAACCCCTGCCCATTTTTGATGTACAGATCCCTCATAGAGGCGAACTGCTCCGTGCCGGCGGTGTCAAGGATCTCCAGCACAGAAGGCGACGAGTCCACCTCGATTTCCTTGCGGTAAAAATCTTCGATGGTCGGGTCATACTTCTCTATAAAGGTCCCGGTTACAAACTGTACAGTCAAGGCGGACTTCCCGACC

Function

symbol description
rap2a Enables GTPase activity; guanyl ribonucleotide binding activity; and magnesium ion binding activity. Involved in several processes, including actin cytoskeleton reorganization; microvillus assembly; and positive regulation of protein autophosphorylation. Acts upstream of or within establishment of protein localization. Located in plasma membrane and recycling endosome membrane.

NR:

description
PREDICTED: ras-related protein Rap-2a isoform X1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU89673 True 274 lncRNA 0.51 1 25508597 25508870

Neighbor

gene id symbol gene type direction distance location
AMCG00014650 NA coding downstream 109763 25397830 ~ 25398834 (-)
AMCG00014647 NA coding downstream 269011 25165946 ~ 25239586 (-)
AMCG00014645 NA coding downstream 365229 25130338 ~ 25143368 (-)
AMCG00014642 NA coding downstream 434887 25004505 ~ 25073710 (-)
AMCG00014641 sox21 coding downstream 546908 24960946 ~ 24961689 (-)
AMCG00014656 stk24,LOC103147175 coding upstream 200764 25709634 ~ 25729632 (-)
AMCG00014659 NA coding upstream 244978 25753848 ~ 25763919 (-)
AMCG00014658 dock9,LOC106586262 coding upstream 266099 25774969 ~ 25851971 (-)
AMCG00014663 NA coding upstream 392579 25901449 ~ 25901694 (-)
AMCG00014662 NA coding upstream 393034 25901904 ~ 26035827 (-)
G71723 NA non-coding downstream 17946 25488226 ~ 25490651 (-)
G71593 NA non-coding downstream 1352449 24155730 ~ 24156148 (-)
G71591 NA non-coding downstream 1427850 24080548 ~ 24080747 (-)
G71583 NA non-coding downstream 1802731 23705566 ~ 23705866 (-)
G71582 NA non-coding downstream 1803177 23705199 ~ 23705420 (-)
G71727 NA non-coding upstream 22068 25530938 ~ 25533180 (-)
G71740 ipo5,kpnb3,LOC107730386,LOC107555240 non-coding upstream 81948 25590818 ~ 25591551 (-)
G71835 NA non-coding upstream 518665 26027535 ~ 26028500 (-)
G71871 NA non-coding upstream 712324 26221194 ~ 26221397 (-)
G71873 NA non-coding upstream 726541 26235411 ~ 26235615 (-)
AMCG00014630 LOC107672672 other downstream 3263682 22225924 ~ 22244915 (-)
AMCG00014603 tpt1,LOC106582181 other downstream 6283367 19217722 ~ 19225230 (-)
AMCG00014604 kctd4,LOC107688678,LOC107748885 other downstream 6305030 19201803 ~ 19203567 (-)
AMCG00014567 mzt1,si:dkey-15d12.2 other downstream 7486502 17990651 ~ 18022095 (-)
AMCG00014559 NA other downstream 7887446 17589267 ~ 17621151 (-)
AMCG00014693 NA other upstream 1776550 27285420 ~ 27304597 (-)
AMCG00014692 LOC107756725 other upstream 1826825 27335695 ~ 27369527 (-)
G72236 rpl8,LOC107595836,LOC107748161 other upstream 2820869 28329739 ~ 28332482 (-)
G72477 LOC106598269,LOC101158751,LOC106586690,LOC103361283 other upstream 3880420 29389290 ~ 29398305 (-)
AMCG00014775 NA other upstream 5332653 30841523 ~ 30846800 (-)

Expression


Co-expression Network