G73608


Basic Information

Item Value
gene id G73608
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030128.1
NCBI id CM030128.1
chromosome length 42883965
location 36194050 ~ 36194315 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU91947
ctcaatgaaaaccatattcttggagatagtcaacatgggtttagacgaggcagatcatgtcttactaatttattaaaaaaatttgaacatgcaactgcagctgtagatcatgtgaaagcatatgatatgatatacttagatttccaaaaagcttttgataaggttccacaccaaagactgatcctcaaattggaagctgtatgcattcagggtaatgtaagtagatggattatgaactggttgatgtatagaaaacagagggtgtc

Function

GO: NA

KEGG:

id description
ko04974 Protein digestion and absorption

RNA

RNA id representative length rna type GC content exon number start site end site
TU91947 True 266 lncRNA 0.35 1 36194050 36194315

Neighbor

gene id symbol gene type direction distance location
AMCG00014837 NA coding upstream 642243 35551157 ~ 35551807 (+)
AMCG00014834 NA coding upstream 719681 35464001 ~ 35474369 (+)
AMCG00014835 NA coding upstream 811147 35370984 ~ 35382903 (+)
AMCG00014833 NA coding upstream 873068 35027857 ~ 35320982 (+)
AMCG00014831 NA coding upstream 1262190 34691085 ~ 34931860 (+)
AMCG00014848 tmprss3,LOC107748899 coding downstream 101401 36295716 ~ 36297723 (+)
AMCG00014850 NA coding downstream 423350 36617665 ~ 36733253 (+)
AMCG00014852 NA coding downstream 719085 36913400 ~ 36914503 (+)
AMCG00014853 cyh2,cyth4,LOC107558519,LOC107555099 coding downstream 806315 37000630 ~ 37030062 (+)
AMCG00014862 NA coding downstream 1502345 37696660 ~ 37706352 (+)
G73525 NA non-coding upstream 96102 36097280 ~ 36097948 (+)
G73471 NA non-coding upstream 451203 35740535 ~ 35742847 (+)
G73463 NA non-coding upstream 509892 35674973 ~ 35684158 (+)
G73462 NA non-coding upstream 522000 35671778 ~ 35672050 (+)
G73431 NA non-coding upstream 691616 35497197 ~ 35502434 (+)
G73616 NA non-coding downstream 63913 36258228 ~ 36258468 (+)
G73619 LOC107575789 non-coding downstream 110269 36304584 ~ 36349056 (+)
G73638 NA non-coding downstream 282293 36476608 ~ 36477950 (+)
G73641 NA non-coding downstream 295868 36490183 ~ 36500130 (+)
G73689 NA non-coding downstream 460640 36654955 ~ 36689065 (+)
AMCG00014836 NA other upstream 781463 35390634 ~ 35412587 (+)
G73343 NA other upstream 1233603 34942011 ~ 34960447 (+)
G73329 NA other upstream 1413460 34780122 ~ 34780590 (+)
G73292 LOC100846954 other upstream 1954650 34238934 ~ 34239400 (+)
G73244 NA other upstream 2827950 33364755 ~ 33366100 (+)
G73850 NA other downstream 1323793 37518108 ~ 37518406 (+)
G74114 NA other downstream 2238059 38432374 ~ 38432861 (+)
G74227 NA other downstream 2616378 38810693 ~ 38811128 (+)
G74348 NA other downstream 3141953 39336268 ~ 39475819 (+)
AMCG00014909 ankrd54 other downstream 3389723 39584038 ~ 39588507 (+)

Expression


Co-expression Network