G74486



Basic Information


Item Value
gene id G74486
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information


Item Value
chromosome id CM030128.1
NCBI id CM030128.1
chromosome length 42883965
location 39682255 ~ 39722288 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence


>TU92991
acacacacacacacacacacacatatatacactcacctaaaggattattaggaacaccatactaatactgtgtttgaccccctttcgccttcagaactgccttaattctacgtggcattgattcaacaaggtgctgaaagcattctttagaaatgttggcccatattgataggatagcatcttgcagttgatggagatttgtgggatgcacatcca
>TU92992
tggatacagagtcagttgaaaatggatggttatacactcacctaaaggattattaggaacaccatactaatactgtgtttgaccccctttcgccttcagaactgccttaattctacgtggcattgattcaacaaggtgctgaaagcattctttagaaatgttggcccatattgataggatagcatcttgcagttgatggagatttgtgggatgcacatcca

Function


GO:

id name namespace
GO:0031399 regulation of protein modification process biological_process
GO:0031400 negative regulation of protein modification process biological_process

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU92991 False 216 lncRNA 0.41 2 39682255 39722288
TU92992 True 221 lncRNA 0.41 2 39695162 39722288

Neighbor


gene id symbol gene type direction distance location
AMCG00014911 mcm5,LOC106607002 coding upstream 45694 39630690 ~ 39636561 (+)
AMCG00014912 gcat coding upstream 56055 39623426 ~ 39626200 (+)
AMCG00014907 hmgxb4,LOC106607053,LOC106601319 coding upstream 106667 39565733 ~ 39575588 (+)
AMCG00014908 NA coding upstream 152444 39511772 ~ 39529811 (+)
AMCG00014904 ttc26,LOC106607033 coding upstream 292568 39381101 ~ 39389687 (+)
AMCG00014922 NA coding downstream 110180 39832468 ~ 39846425 (+)
AMCG00014921 wbp11 coding downstream 153912 39876200 ~ 39887566 (+)
AMCG00014926 LOC106607097,LOC107574926 coding downstream 165812 39888100 ~ 39899640 (+)
AMCG00014929 NA coding downstream 263017 39985305 ~ 39990486 (+)
AMCG00014931 NA coding downstream 391840 40114128 ~ 40140409 (+)
G74491 NA non-coding upstream 22297 39659533 ~ 39659958 (+)
G74484 NA non-coding upstream 22743 39647829 ~ 39659512 (+)
G74459 NA non-coding upstream 80157 39601852 ~ 39602098 (+)
G74442 NA non-coding upstream 97096 39584922 ~ 39585159 (+)
G74422 NA non-coding upstream 182595 39498703 ~ 39499660 (+)
G74505 NA non-coding downstream 4178 39726466 ~ 39734537 (+)
G74511 NA non-coding downstream 21837 39744125 ~ 39744360 (+)
G74513 NA non-coding downstream 29909 39752197 ~ 39752551 (+)
G74516 NA non-coding downstream 33102 39755390 ~ 39755664 (+)
G74521 NA non-coding downstream 73824 39796112 ~ 39840618 (+)
AMCG00014913 NA other upstream 61069 39606887 ~ 39621186 (+)
AMCG00014909 ankrd54 other upstream 93748 39584038 ~ 39588507 (+)
G74348 NA other upstream 206436 39336268 ~ 39475819 (+)
G74227 NA other upstream 871127 38810693 ~ 38811128 (+)
G74114 NA other upstream 1249394 38432374 ~ 38432861 (+)
AMCG00014923 NA other downstream 142794 39865082 ~ 39875428 (+)
AMCG00014925 NA other downstream 228900 39951188 ~ 39953278 (+)
AMCG00014928 NA other downstream 241480 39963768 ~ 39973070 (+)
G74642 NA other downstream 437613 40159901 ~ 40160578 (+)
G74643 NA other downstream 439728 40162016 ~ 40163997 (+)

Expression



Co-expression Network