AMCG00015513


Basic Information

Item Value
gene id AMCG00015513
gene name NA
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030132.1
NCBI id CM030132.1
chromosome length 32980562
location 10554666 ~ 10555449 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00015513
ACAGGTGGTGGGGGTGGGCTGCTCCGGCTCGCTTTCGCCGGGGAGCGGGTGGGGGAACACCGAGAGGAGCCCTTACCGAGAGGGAGCGGCGAGGCCGGGGCGCCGGGGCGGGGAGCGGAGAGGGGCGAGGCCGCTGCCGCAGACAAAGGGATCGGGGAACAGAGCTCGCTGACACCCGGCGCGGCTGAACAAGACACGGGGAGGCTTCTAGCCGACGCCAGCCAGCTAACGGGCCGAGAACCCAGCCGTCCTCCAGCGCTGGGGCATCTGACTGAGCAGGACTAG

Function

GO: NA

KEGG:

id description
ko04260 Cardiac muscle contraction
ko04974 Protein digestion and absorption

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00015513 True 285 mRNA 0.71 2 10554666 10555449

Neighbor

gene id symbol gene type direction distance location
AMCG00015510 sssca1 coding upstream 1210 10547776 ~ 10553456 (+)
AMCG00015511 NA coding upstream 7902 10543262 ~ 10546764 (+)
AMCG00015509 NA coding upstream 12719 10539920 ~ 10541947 (+)
AMCG00015512 NA coding upstream 37627 10512635 ~ 10517039 (+)
AMCG00015505 LOC103385808,LOC107690779,LOC103366237,LOC103033313,LOC102208922 coding upstream 65349 10484942 ~ 10489317 (+)
AMCG00015517 LOC100380650 coding downstream 12060 10567509 ~ 10604062 (+)
AMCG00015516 NA coding downstream 57959 10613408 ~ 10626064 (+)
AMCG00015522 NA coding downstream 179910 10735359 ~ 10736975 (+)
AMCG00015521 NA coding downstream 184021 10739470 ~ 10742405 (+)
AMCG00015520 LOC106560356 coding downstream 213935 10769384 ~ 10772564 (+)
G98312 NA non-coding upstream 57604 10496836 ~ 10497062 (+)
G98311 NA non-coding upstream 59715 10494524 ~ 10494951 (+)
G98310 NA non-coding upstream 60965 10489908 ~ 10493701 (+)
G98299 NA non-coding upstream 122622 10428585 ~ 10432044 (+)
G98282 NA non-coding upstream 175635 10378607 ~ 10379031 (+)
G98398 NA non-coding downstream 152972 10708421 ~ 10708753 (+)
G98422 NA non-coding downstream 264299 10819748 ~ 10820170 (+)
G98430 NA non-coding downstream 368683 10924132 ~ 10938566 (+)
G98442 NA non-coding downstream 433407 10988856 ~ 11019109 (+)
G98569 NA non-coding downstream 911403 11466852 ~ 11468628 (+)
G98302 NA other upstream 104003 10448166 ~ 10450663 (+)
AMCG00015504 NA other upstream 135966 10411887 ~ 10418700 (+)
G98251 NA other upstream 237341 10316908 ~ 10317325 (+)
AMCG00015492 NA other upstream 332170 10213001 ~ 10222496 (+)
G98093 NA other upstream 468154 10085428 ~ 10086512 (+)
G98402 NA other downstream 180530 10735979 ~ 10741133 (+)
AMCG00015528 NA other downstream 317221 10872670 ~ 11227821 (+)
AMCG00015539 NA other downstream 504041 11059490 ~ 11066855 (+)
AMCG00015544 LOC105903120,LOC107562780,LOC108434861,LOC107691965,LOC106577530,LOC107742298 other downstream 802703 11358152 ~ 11416599 (+)
AMCG00015555 NA other downstream 1878717 12434166 ~ 12462665 (+)

Expression


Co-expression Network