G100863


Basic Information

Item Value
gene id G100863
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030132.1
NCBI id CM030132.1
chromosome length 32980562
location 23839798 ~ 23961637 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU125964
tcattgtcatgttcaaagtccaatcatttcaaattggtttcttgaacatgacaatgagttcactgtactaaactggcccccacagtcaccagatctcaacccaatagagcatctttgggatgtggtggaacgggagcttcgtgccctggatgtgcatcccacaaatctccatcaactgcaagatgctatcctatcaatatgggccaacatttctaaagaatgctttcagcaccttgttgaatcaatgccacgtagaattaaggcagttctgaaggcgaaaggag

Function

GO:

id name namespace
GO:0030162 regulation of proteolysis biological_process
GO:0052547 regulation of peptidase activity biological_process
GO:0051336 regulation of hydrolase activity biological_process
GO:0021510 spinal cord development biological_process
GO:0021514 ventral spinal cord interneuron differentiation biological_process
GO:0021515 cell differentiation in spinal cord biological_process
GO:0021517 ventral spinal cord development biological_process
GO:0005540 hyaluronic acid binding molecular_function
GO:0031406 carboxylic acid binding molecular_function
GO:0043177 organic acid binding molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU125964 True 284 lncRNA 0.44 3 23839798 23961637

Neighbor

gene id symbol gene type direction distance location
AMCG00015829 NA coding upstream 79172 23747430 ~ 23760626 (+)
AMCG00015822 NA coding upstream 106118 23713609 ~ 23733680 (+)
AMCG00015824 LOC107749771,LOC105028844,LOC106611650,LOC106604646 coding upstream 368095 23460327 ~ 23471703 (+)
AMCG00015823 LOC108249661,LOC107749771,LOC105028844,LOC106611650,LOC106604646 coding upstream 385902 23413178 ~ 23453896 (+)
AMCG00015826 NA coding upstream 447319 23368196 ~ 23392479 (+)
AMCG00015830 tusc3 coding downstream 27602 23989239 ~ 23998009 (+)
AMCG00015833 micu3,LOC107562929,LOC107656542,LOC107747394,LOC102779354,LOC101479276 coding downstream 276183 24237820 ~ 24265831 (+)
AMCG00015834 NA coding downstream 328732 24290369 ~ 24306093 (+)
AMCG00015835 LOC107554395,LOC105892576,LOC104947301 coding downstream 383987 24345624 ~ 24353418 (+)
AMCG00015837 NA coding downstream 453487 24415124 ~ 24439833 (+)
G100858 NA non-coding upstream 77275 23762291 ~ 23762523 (+)
G100801 NA non-coding upstream 555721 23283691 ~ 23284077 (+)
G100776 NA non-coding upstream 621482 23216051 ~ 23218316 (+)
G100709 NA non-coding upstream 916402 22835254 ~ 22923396 (+)
G100707 NA non-coding upstream 1019095 22820501 ~ 22820703 (+)
G100903 NA non-coding downstream 109189 24070826 ~ 24156851 (+)
G100956 NA non-coding downstream 523192 24484829 ~ 24549300 (+)
G100962 NA non-coding downstream 567123 24528760 ~ 24537309 (+)
G100998 asah1,LOC102779657 non-coding downstream 634837 24596474 ~ 24597817 (+)
G101029 frg1,LOC107721419,LOC107702291,LOC107554393,LOC107656998,LOC107747397,LOC102296826 non-coding downstream 641665 24603302 ~ 24608554 (+)
AMCG00015796 hspa12b,LOC107583310,LOC107697252,LOC107721672 other upstream 1155903 22678837 ~ 22683895 (+)
G100338 herc3 other upstream 3571513 20267407 ~ 20268285 (+)
AMCG00015725 smad1 other upstream 5067832 18744887 ~ 18771966 (+)
G100007 NA other upstream 5513894 18320056 ~ 18325904 (+)
AMCG00015703 rps3a,LOC106592945 other upstream 6708023 17098459 ~ 17131775 (+)
G101061 NA other downstream 903452 24865089 ~ 24865552 (+)
G101248 NA other downstream 2302278 26263915 ~ 26264308 (+)
G101275 NA other downstream 2411516 26373153 ~ 26377699 (+)
G101400 NA other downstream 3928915 27890552 ~ 27992014 (+)
AMCG00015901 NA other downstream 4615863 28577500 ~ 28580829 (+)

Expression


Co-expression Network