AMCG00016019 (robo1,LOC106613191)



Basic Information


Item Value
gene id AMCG00016019
gene name robo1,LOC106613191
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information


Item Value
chromosome id CM030122.1
NCBI id CM030122.1
chromosome length 54868152
location 1459072 ~ 1459832 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence


>AMCG00016019
ATGCTCCTTAGGAAAAAATTGTTCCCCTCTCCTCTGCCTTGTGTCCCAGGATCCCGCCTTCGCCAGGAGGACTCCCCGCCCCGGATCGTGGAGCACCCGTCTGACCTGATCGTGTCCAAGGGGGAGCCGGCCACCCTCAACTGTAAGGCGGAGGGCCGGCCCAGCCCCACGGTGGAGTGGTACAAGGACGGGGAACGGGTGGAGACGGACAAGGATGACCCACGCTCTCACCGCATGCTGCTGCCCAGCGGCTCGCTCTTCTTCCTGCGCATCGTGCACGGCCGCCGCAGCAAGCCAGACGAGGGCAGCTACGTGTGCGTCGCCCGCAACTACCTGGGGGAGGCCGTCAGCCACAACGCGTCCCTGGAGGTGGCCACGGGAGTGATTGATGCAGGGCAGGGCTTATCTGTGTGA

Function


symbol description
robo1 Predicted to enable axon guidance receptor activity. Acts upstream of or within axon guidance and endocardial progenitor cell migration to the midline involved in heart field formation. Predicted to be located in membrane. Predicted to be integral component of membrane. Is expressed in basal plate midbrain region; epidermis; nervous system; pectoral fin; and pharyngeal arch. Orthologous to human ROBO1 (roundabout guidance receptor 1).

NR:

description
PREDICTED: roundabout homolog 1 isoform X4

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
AMCG00016019 True 414 mRNA 0.65 3 1459072 1459832

Neighbor


gene id symbol gene type direction distance location
AMCG00016020 robo1 coding downstream 117861 1313779 ~ 1341211 (-)
AMCG00016018 NA coding downstream 146987 1263535 ~ 1312085 (-)
AMCG00016010 NA coding downstream 1262174 187079 ~ 196898 (-)
AMCG00016012 NA coding downstream 1277535 159706 ~ 181537 (-)
AMCG00016013 NA coding downstream 1305099 149601 ~ 153973 (-)
AMCG00016023 NA coding upstream 1003239 2463071 ~ 2515080 (-)
AMCG00016022 NA coding upstream 1059711 2519543 ~ 2527277 (-)
AMCG00016026 NA coding upstream 1136182 2596014 ~ 2600477 (-)
AMCG00016027 NA coding upstream 1146876 2606708 ~ 2671709 (-)
AMCG00016028 timm10b coding upstream 1255137 2714969 ~ 2715852 (-)
G10233 NA non-coding downstream 1136072 322629 ~ 323000 (-)
G10229 NA non-coding downstream 1187549 270921 ~ 271523 (-)
G10214 NA non-coding downstream 1257956 200279 ~ 201116 (-)
G10298 NA non-coding upstream 73569 1533401 ~ 1533655 (-)
G10307 NA non-coding upstream 236973 1696805 ~ 1705596 (-)
G10314 NA non-coding upstream 384096 1843928 ~ 1844160 (-)
G10319 NA non-coding upstream 448093 1907925 ~ 1908294 (-)
G10321 NA non-coding upstream 458597 1918429 ~ 1919336 (-)
AMCG00016024 ilk,LOC106581335 other upstream 1072785 2532617 ~ 2554946 (-)
G10420 LOC101154678 other upstream 1250567 2710399 ~ 2710685 (-)
AMCG00016029 NA other upstream 1324293 2784125 ~ 2846357 (-)
G10478 NA other upstream 1574590 3034422 ~ 3035183 (-)
AMCG00016046 NA other upstream 2069010 3528842 ~ 3542536 (-)

Expression



Co-expression Network