AMCG00016028 (timm10b)



Basic Information


Item Value
gene id AMCG00016028
gene name timm10b
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information


Item Value
chromosome id CM030122.1
NCBI id CM030122.1
chromosome length 54868152
location 2714969 ~ 2715852 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence


>AMCG00016028
CTAAGGGATTTTCTCCTGGTTTACAATAAGATGACAGAAATCTGTTTCCAGCGCTGCACAAATAACCTGAACTACAGGACAATGACAATGGATGAAGAGCATTGTCTGGACAGCTGTGCTGGTAAGCTGATTCGCTCCAATCACCGGCTCATGGCCACCTATGTCCAGCTCATGCCTGGCATTGTGCAGCGGAGACTGGCGGAGTACGAGAGCAAGGCGGAGCAGATGGCACAGGCATCCAGGGCAGGCACTTCTCCTGACCAGAGCATCCCTCTGCCTGTTGAAGGCAGTGCCCTTCCAGAACATAGCAGTCAGACAATACCCAGCAACAGCACCACACAGGCCCCTGACACTCCTCACTGA

Function


symbol description
timm10b Predicted to enable metal ion binding activity. Predicted to act upstream of or within protein transport. Predicted to be located in mitochondrial inner membrane. Predicted to be part of TIM22 mitochondrial import inner membrane insertion complex and mitochondrial intermembrane space protein transporter complex. Orthologous to human TIMM10B (translocase of inner mitochondrial membrane 10B).

NR:

description
PREDICTED: mitochondrial import inner membrane translocase subunit Tim10 B

GO: NA

KEGG:

id description
K17779 TIM10B; mitochondrial import inner membrane translocase subunit TIM10B

RNA


RNA id representative length rna type GC content exon number start site end site
AMCG00016028 True 363 mRNA 0.53 2 2714969 2715852

Neighbor


gene id symbol gene type direction distance location
AMCG00016027 NA coding downstream 43260 2606708 ~ 2671709 (-)
AMCG00016026 NA coding downstream 114492 2596014 ~ 2600477 (-)
AMCG00016022 NA coding downstream 187692 2519543 ~ 2527277 (-)
AMCG00016023 NA coding downstream 199889 2463071 ~ 2515080 (-)
AMCG00016019 robo1,LOC106613191 coding downstream 1255137 1459072 ~ 1459832 (-)
AMCG00016041 NA coding upstream 747814 3463666 ~ 3475993 (-)
AMCG00016042 NA coding upstream 781850 3497702 ~ 3502851 (-)
AMCG00016047 NA coding upstream 907066 3622918 ~ 3668558 (-)
AMCG00016045 NA coding upstream 1067682 3783534 ~ 3784496 (-)
AMCG00016050 NA coding upstream 1107399 3823251 ~ 3835355 (-)
G10415 NA non-coding downstream 12457 2696669 ~ 2702512 (-)
G10357 NA non-coding downstream 289489 2425021 ~ 2425480 (-)
G10346 NA non-coding downstream 457254 2257416 ~ 2257715 (-)
G10343 NA non-coding downstream 464328 2250401 ~ 2250641 (-)
G10324 NA non-coding downstream 627419 2087271 ~ 2087550 (-)
G10432 NA non-coding upstream 20329 2736181 ~ 2736474 (-)
G10435 NA non-coding upstream 33806 2749658 ~ 2749864 (-)
G10440 NA non-coding upstream 49642 2765494 ~ 2767457 (-)
G10464 NA non-coding upstream 157372 2873224 ~ 2963628 (-)
G10474 NA non-coding upstream 262145 2977997 ~ 2978208 (-)
G10420 LOC101154678 other downstream 4284 2710399 ~ 2710685 (-)
AMCG00016024 ilk,LOC106581335 other downstream 160023 2532617 ~ 2554946 (-)
AMCG00016029 NA other upstream 68273 2784125 ~ 2846357 (-)
G10478 NA other upstream 318570 3034422 ~ 3035183 (-)
AMCG00016046 NA other upstream 812990 3528842 ~ 3542536 (-)
AMCG00016049 NA other upstream 1170446 3886298 ~ 3920503 (-)
AMCG00016074 NA other upstream 2188004 4903856 ~ 4929900 (-)

Expression



Co-expression Network