AMCG00016053 (lhfp,LOC105029023,LOC107670626,LOC107740377,LOC107593461)


Basic Information

Item Value
gene id AMCG00016053
gene name lhfp,LOC105029023,LOC107670626,LOC107740377,LOC107593461
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030122.1
NCBI id CM030122.1
chromosome length 54868152
location 4104731 ~ 4105731 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00016053
ATGGATAAACCGGTTTCGTTTGGCACTTTTCGCCGGTGCTCCTATCCTGTCAGGGACGAGACCCGGCAGCTGACGGTGATGGTGGAGCAGTGCGGACGGTACGCTTCTTTCCAGGGCATCCCCAGCTTGGAGTGGAAGATCTGCACCGTGGTGACCGGGGTGGGCTGCGGGCTGCTGCTCCTAGTGGCTCTCACTGCCCTCATGGGATGCTGCGTGTCGGAGCTCATTTCCCGGACAATTGGCAGGGTGGCCGGCGGAGTGCAGTTCGTTGGCGTTGCAGCGCACATGTGTTGCCTACCTCTGCCCGATGGGGGCGCCAATGGGCACTGTGTATCTGACCGCATTTTACAGGTGTGGATGAAGTGA

Function

symbol description
lhfp Predicted to be integral component of membrane. Predicted to be active in membrane. Is expressed in several structures, including brain; genitourinary system; hemolymphoid system gland; skin; and spinal cord lateral wall. Orthologous to human LHFPL6 (LHFPL tetraspan subfamily member 6).

NR:

description
PREDICTED: lipoma HMGIC fusion partner

GO: NA

KEGG:

id description
K23893 LHFPL; LHFPL tetraspan subfamily member protein

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00016053 True 366 mRNA 0.60 2 4104731 4105731

Neighbor

gene id symbol gene type direction distance location
AMCG00016048 NA coding downstream 157296 3928734 ~ 3947435 (-)
AMCG00016050 NA coding downstream 269376 3823251 ~ 3835355 (-)
AMCG00016045 NA coding downstream 320235 3783534 ~ 3784496 (-)
AMCG00016047 NA coding downstream 436173 3622918 ~ 3668558 (-)
AMCG00016042 NA coding downstream 601880 3497702 ~ 3502851 (-)
AMCG00016058 NA coding upstream 270714 4376445 ~ 4378160 (-)
AMCG00016059 foxo1 coding upstream 319257 4424988 ~ 4427749 (-)
AMCG00016063 NA coding upstream 337685 4443416 ~ 4451855 (-)
AMCG00016064 LOC105011210,LOC107718790 coding upstream 370608 4476339 ~ 4490665 (-)
AMCG00016062 NA coding upstream 401732 4507463 ~ 4517486 (-)
G10698 NA non-coding downstream 116776 3987653 ~ 3987955 (-)
G10696 NA non-coding downstream 125614 3977559 ~ 3979117 (-)
G10692 NA non-coding downstream 131220 3971886 ~ 3973511 (-)
G10673 NA non-coding downstream 192459 3869724 ~ 3912272 (-)
G10624 NA non-coding downstream 362469 3741593 ~ 3742262 (-)
G10715 NA non-coding upstream 61047 4166778 ~ 4170338 (-)
G10735 NA non-coding upstream 249122 4354853 ~ 4355296 (-)
G10740 NA non-coding upstream 265734 4371465 ~ 4373721 (-)
G10805 NA non-coding upstream 480992 4586723 ~ 4587875 (-)
G10806 NA non-coding upstream 486089 4591820 ~ 4592077 (-)
AMCG00016049 NA other downstream 184228 3886298 ~ 3920503 (-)
AMCG00016046 NA other downstream 562195 3528842 ~ 3542536 (-)
G10478 NA other downstream 1069548 3034422 ~ 3035183 (-)
AMCG00016029 NA other downstream 1258374 2784125 ~ 2846357 (-)
G10420 LOC101154678 other downstream 1394046 2710399 ~ 2710685 (-)
AMCG00016074 NA other upstream 798125 4903856 ~ 4929900 (-)
AMCG00016110 ufm1,LOC107701138 other upstream 3575180 7680911 ~ 7753437 (-)
AMCG00016119 NA other upstream 4013490 8119221 ~ 8124033 (-)
G11326 NA other upstream 4085815 8191546 ~ 8194432 (-)
AMCG00016134 NA other upstream 4717814 8823545 ~ 8827760 (-)

Expression


Co-expression Network