AMCG00016254 (uvrag,LOC106603537,LOC106567946)


Basic Information

Item Value
gene id AMCG00016254
gene name uvrag,LOC106603537,LOC106567946
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030122.1
NCBI id CM030122.1
chromosome length 54868152
location 13726371 ~ 13742178 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00016254
GCTGCACACGACGCAACGTGCCATCAAGCAGACCCAGATGACGGTGCACAAGATTGGGAAAGAGATCGAAGAGAAGCTCAGGAGGACCGCGGACAGCACAGACAAGAAGAAGGAGCGGGAGTGTATCCAGTTGCGGATCGGCGTGCTGCGCAACGAGCTGGAGAGGCAGAGGAAAGCGCTGGGCAGAGAGCTGGAGACCCGACAGAAAGAGAACACCCTGCTGCAGAAGAAAGAGGAGGCATTCTCAAACAAGCACCAGAGCTTGGAAATGGAGAAGGAGTCCTTAACGGAGCAACAGAAAGAATGCACTGCCAAGAGAGAGCTGTTTTTAAAGACCAATGCACAGCTTACCTTTCGATGTCGACAGCTGCTCACAGAACTCTCTTACATATATCCAATAGATGTGAACAATCAAACAGATTATGTCATCTGTGGGGTGAAGCTGCCAAACTCAGAGGATTTTCAAGCGAAGGATGACGGGAGTGTGGCGGTTGCCCTGGGTTACACCGCACACCTGGTTCTGATGATCTCCTGCTTCCTGCAGATCCCTCTC

Function

symbol description
uvrag Predicted to enable SNARE binding activity. Acts upstream of or within melanocyte differentiation. Predicted to be active in endosome and lytic vacuole. Orthologous to human UVRAG (UV radiation resistance associated).

NR:

description
PREDICTED: UV radiation resistance-associated gene protein-like

GO: NA

KEGG:

id description
K21249 UVRAG; UV radiation resistance-associated gene protein

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00016254 True 553 mRNA 0.52 6 13726371 13742178

Neighbor

gene id symbol gene type direction distance location
AMCG00016255 uvrag,LOC107577365,LOC107589407,LOC107686127,LOC107691651 coding upstream 11680 13707214 ~ 13714691 (+)
AMCG00016256 NA coding upstream 20488 13676994 ~ 13705883 (+)
AMCG00016250 NA coding upstream 108727 13597834 ~ 13617644 (+)
AMCG00016249 atg101,LOC107751375,LOC107686213,LOC107589731 coding upstream 137398 13583044 ~ 13588973 (+)
AMCG00016242 NA coding upstream 270455 13445038 ~ 13455916 (+)
AMCG00016253 NA coding downstream 34344 13776522 ~ 13783628 (+)
AMCG00016260 emsy coding downstream 138628 13880806 ~ 13895173 (+)
AMCG00016261 NA coding downstream 207729 13949907 ~ 13954292 (+)
AMCG00016264 NA coding downstream 234602 13976780 ~ 13980445 (+)
AMCG00016265 erg,LOC106567682 coding downstream 327103 14069281 ~ 14084493 (+)
G12368 NA non-coding upstream 66712 13657393 ~ 13659659 (+)
G12347 NA non-coding upstream 86783 13638302 ~ 13639588 (+)
G12331 NA non-coding upstream 174513 13551594 ~ 13551858 (+)
G12330 NA non-coding upstream 179773 13546399 ~ 13546598 (+)
G12289 NA non-coding upstream 252586 13473488 ~ 13473785 (+)
G12406 NA non-coding downstream 87556 13829734 ~ 13830887 (+)
G12487 NA non-coding downstream 440427 14182605 ~ 14184686 (+)
G12489 dyrk1a,LOC107744208 non-coding downstream 452757 14194935 ~ 14196634 (+)
G12549 NA non-coding downstream 641727 14383905 ~ 14384657 (+)
G12566 NA non-coding downstream 655071 14397249 ~ 14398414 (+)
G12351 NA other upstream 89370 13635442 ~ 13637001 (+)
G12349 NA other upstream 94574 13631285 ~ 13631797 (+)
G12348 NA other upstream 98660 13621879 ~ 13627711 (+)
AMCG00016241 NA other upstream 336735 13271584 ~ 13389636 (+)
AMCG00016221 NA other upstream 939472 12778224 ~ 12786899 (+)
G12587 NA other downstream 695593 14437771 ~ 14438606 (+)
AMCG00016288 NA other downstream 1003138 14745316 ~ 14783535 (+)
AMCG00016329 NA other downstream 2742177 16484355 ~ 16486003 (+)
G13012 NA other downstream 3374615 17116793 ~ 17121932 (+)
AMCG00016379 cwf19l2,LOC107560834,LOC107670086,LOC107728743,LOC107566889,LOC107669872 other downstream 3820240 17562418 ~ 17599581 (+)

Expression


Co-expression Network