AMCG00016255 (uvrag,LOC107577365,LOC107589407,LOC107686127,LOC107691651)


Basic Information

Item Value
gene id AMCG00016255
gene name uvrag,LOC107577365,LOC107589407,LOC107686127,LOC107691651
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030122.1
NCBI id CM030122.1
chromosome length 54868152
location 13707214 ~ 13714691 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00016255
ATGAGCTCGGTTGCCGGTCGGGATATCGTTGTCTCTGCCGCCGCTGTCAGCAACGCCGGAGCCGCATCGTCCCGGGCCCTGCACGTCGAGCTCACGTCCCAGCAGCGCCGCCTCCGTCACCTACGCAGCATCGCCGCCCGCAACATCGTGAACAAGAACGGCTCTCCGCTGCTGGACACCTACTTCACTCTGCACCTGTGTGACGACAACTGGATAACCAGAGACTTTTACAAGAGCGAAGTCATAAGGGACTCATTGAACCCAACATGGAGGAGTCTGGACTTCGGCATGCTGCCCGACCTGCTCGACATGTCTGTCTCATGTTTCGTGGTGCGGATCTGGGGCGGTCGGAGGGAGCAGTACCAGCTCCTCATCGAGTGGAAGGTCAACCTGGACGGCCTGCGCTACACCGGACAGCAGATTCGTTCCCGTAATTCCAATGAGATCATATTTGGATTGAATGATGGCTACTATGCAGCCCACTACGATCAGAGGGTAAGAGCAGATACGGAAACTGTCGCTTGCAGGAGGTGTTTGTGTGCTCTGTGGTCAAAGTAA

Function

symbol description
uvrag Predicted to enable SNARE binding activity. Acts upstream of or within melanocyte differentiation. Predicted to be active in endosome and lytic vacuole. Orthologous to human UVRAG (UV radiation resistance associated).

NR:

description
PREDICTED: UV radiation resistance-associated gene protein-like isoform X2

GO:

id name namespace
GO:0010508 positive regulation of autophagy biological_process

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00016255 True 558 mRNA 0.57 5 13707214 13714691

Neighbor

gene id symbol gene type direction distance location
AMCG00016256 NA coding upstream 1331 13676994 ~ 13705883 (+)
AMCG00016250 NA coding upstream 89570 13597834 ~ 13617644 (+)
AMCG00016249 atg101,LOC107751375,LOC107686213,LOC107589731 coding upstream 118241 13583044 ~ 13588973 (+)
AMCG00016242 NA coding upstream 251298 13445038 ~ 13455916 (+)
AMCG00016239 usp25,LOC107653727 coding upstream 460198 13212058 ~ 13247016 (+)
AMCG00016254 uvrag,LOC106603537,LOC106567946 coding downstream 11680 13726371 ~ 13742178 (+)
AMCG00016253 NA coding downstream 61831 13776522 ~ 13783628 (+)
AMCG00016260 emsy coding downstream 166115 13880806 ~ 13895173 (+)
AMCG00016261 NA coding downstream 235216 13949907 ~ 13954292 (+)
AMCG00016264 NA coding downstream 262089 13976780 ~ 13980445 (+)
G12368 NA non-coding upstream 47555 13657393 ~ 13659659 (+)
G12347 NA non-coding upstream 67626 13638302 ~ 13639588 (+)
G12331 NA non-coding upstream 155356 13551594 ~ 13551858 (+)
G12330 NA non-coding upstream 160616 13546399 ~ 13546598 (+)
G12289 NA non-coding upstream 233429 13473488 ~ 13473785 (+)
G12406 NA non-coding downstream 115043 13829734 ~ 13830887 (+)
G12487 NA non-coding downstream 467914 14182605 ~ 14184686 (+)
G12489 dyrk1a,LOC107744208 non-coding downstream 480244 14194935 ~ 14196634 (+)
G12549 NA non-coding downstream 669214 14383905 ~ 14384657 (+)
G12566 NA non-coding downstream 682558 14397249 ~ 14398414 (+)
G12351 NA other upstream 70213 13635442 ~ 13637001 (+)
G12349 NA other upstream 75417 13631285 ~ 13631797 (+)
G12348 NA other upstream 79503 13621879 ~ 13627711 (+)
AMCG00016241 NA other upstream 317578 13271584 ~ 13389636 (+)
AMCG00016221 NA other upstream 920315 12778224 ~ 12786899 (+)
G12587 NA other downstream 723080 14437771 ~ 14438606 (+)
AMCG00016288 NA other downstream 1030625 14745316 ~ 14783535 (+)
AMCG00016329 NA other downstream 2769664 16484355 ~ 16486003 (+)
G13012 NA other downstream 3402102 17116793 ~ 17121932 (+)
AMCG00016379 cwf19l2,LOC107560834,LOC107670086,LOC107728743,LOC107566889,LOC107669872 other downstream 3847727 17562418 ~ 17599581 (+)

Expression


Co-expression Network