AMCG00016390 (dync2h1,LOC106613216,LOC106593015)


Basic Information

Item Value
gene id AMCG00016390
gene name dync2h1,LOC106613216,LOC106593015
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030122.1
NCBI id CM030122.1
chromosome length 54868152
location 17935136 ~ 17948136 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00016390
TGTCCACTGAGTTGGCAGAACAAATGGGAAGGCCCAGAAGATCCCATGCTGTACCTCAGAGCAGTGGTGGCTCGAGCACTTGCTATACAGAGCTGGGTTGATAGGTCAGAGAAACAGAGCCTCCTCTCAGACACGCTCGACCTGTCTGAACTCTTCCACCCGGACACCTTCCTCAATGCACTCAGACAGGAGACTGCAAGATCAATGGGCTGCTCAATGGACAGTCTGAGGTTCATAGCATCTTGGAAAAGCAAAATTGCAGAGGCCAAGCTCCAAGTCAAGATTGGTGGCTTGAAACTGGAAGGGTGCAGTTTTGACGGAAACCGGCTTTCAGAGAACCAGCATGACTCTCCCAGCGTGTCGGCAGTGCCCTCTTGTTATATGGCCTGGATTCCTCAGGGTGCCAGTGGGTCTCACCCTGCTGAAGAGAGCATTTCTCTGCCCGTGTACACCAGTGCTGAGAGAGCGCGCGTGGTGACCAACATCGACGTGCCTTGTGGCGGGAGCCCGGACCAGTGGATCCAGAGTGGGGCGGCTCTGTTTCTAAAGCAGCAGTAG

Function

symbol description
dync2h1 Acts upstream of or within cilium assembly and intraciliary transport. Located in non-motile cilium. Is expressed in central nervous system; pronephric duct; and retina. Human ortholog(s) of this gene implicated in asphyxiating thoracic dystrophy 3. Orthologous to human DYNC2H1 (dynein cytoplasmic 2 heavy chain 1).

NR:

description
PREDICTED: cytoplasmic dynein 2 heavy chain 1

GO:

id name namespace
GO:0001539 cilium or flagellum-dependent cell motility biological_process
GO:0007018 microtubule-based movement biological_process
GO:0006200 obsolete ATP catabolic process biological_process
GO:0030031 cell projection assembly biological_process
GO:0030286 dynein complex cellular_component
GO:0005524 ATP binding molecular_function
GO:0003777 microtubule motor activity molecular_function
GO:0016887 ATPase activity molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00016390 True 558 mRNA 0.55 5 17935136 17948136

Neighbor

gene id symbol gene type direction distance location
AMCG00016382 LOC107706429,LOC107681140,LOC107548160,LOC107718985 coding downstream 148041 17785858 ~ 17787095 (-)
AMCG00016383 gria4,gria4a,gria4b,LOC107756206 coding downstream 186386 17740632 ~ 17748750 (-)
AMCG00016385 gria4 coding downstream 218153 17715768 ~ 17716983 (-)
AMCG00016384 LOC107548160,LOC108279362,LOC108440167,LOC103155416 coding downstream 230751 17696929 ~ 17704385 (-)
AMCG00016381 NA coding downstream 248399 17678130 ~ 17686737 (-)
AMCG00016389 dync2h1,LOC106613216,LOC108413322,LOC107566891,LOC103461033 coding upstream 37295 17985431 ~ 18004633 (-)
AMCG00016391 dync2h1,LOC106613214 coding upstream 71903 18020039 ~ 18069565 (-)
AMCG00016392 fzd4,LOC107600811,LOC107551868 coding upstream 138631 18086767 ~ 18091557 (-)
AMCG00016395 rab38 coding upstream 280975 18229111 ~ 18242329 (-)
AMCG00016396 NA coding upstream 311024 18259160 ~ 18262198 (-)
G13129 NA non-coding downstream 438789 17495923 ~ 17496347 (-)
G13126 NA non-coding downstream 440790 17493855 ~ 17494346 (-)
G13091 NA non-coding downstream 557597 17375266 ~ 17377539 (-)
G13065 clns1a,LOC102781126 non-coding downstream 648307 17284403 ~ 17286829 (-)
G13045 rps3 non-coding downstream 688806 17241944 ~ 17246330 (-)
G13254 NA non-coding upstream 214651 18162787 ~ 18165770 (-)
G13334 NA non-coding upstream 878058 18826194 ~ 18901976 (-)
G13339 NA non-coding upstream 1110269 19058405 ~ 19058673 (-)
G13341 NA non-coding upstream 1129232 19077368 ~ 19077823 (-)
G13366 NA non-coding upstream 1140088 19088224 ~ 19088632 (-)
AMCG00016376 NA other downstream 393794 17538034 ~ 17541342 (-)
AMCG00016360 aamdc,LOC107658908,LOC107660681,LOC107600345,LOC107600309 other downstream 668389 17263601 ~ 17266747 (-)
AMCG00016345 NA other downstream 1065134 16866318 ~ 16870002 (-)
G12945 ucp2,ucp2b,LOC106567822 other downstream 1073957 16858541 ~ 16861179 (-)
AMCG00016327 NA other downstream 1459966 16470611 ~ 16475170 (-)
G13367 NA other upstream 1143103 19091239 ~ 19105381 (-)
AMCG00016453 NA other upstream 2180772 20128908 ~ 20135547 (-)
AMCG00016479 NA other upstream 2668373 20616509 ~ 20636960 (-)
AMCG00016480 NA other upstream 2718006 20666142 ~ 20683024 (-)
G13962 NA other upstream 5506956 23455092 ~ 23455811 (-)

Expression


Co-expression Network