AMCG00016601 (neurod2,LOC102791336,LOC102193051,LOC101464503)


Basic Information

Item Value
gene id AMCG00016601
gene name neurod2,LOC102791336,LOC102193051,LOC101464503
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030122.1
NCBI id CM030122.1
chromosome length 54868152
location 25824746 ~ 25825846 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00016601
ATGTTGACGAGGCTGTTCAGCGACCCCTCCCTGCTGCCCGAGGTGCAGAAGTACTCGGGCTGGGCGGATGACAGCGAGAGCGAGGACTCCAAGGCCAAGGACGACGACCAGGAGCACGGCTGCGGCCTGCAAGATGACGATGATCTGGATGACGGGGACCTCAGAGGCGACAGCAGCAGGGCCCAATCGGAAATAGCTGGCGAGGACGAGGAGGATGATGATGGTGAAGAGGAGGACGGGGGTGAGGAGACTGAGGGAGAAAGGCCAAAAAAACGGGGCCCGAAGAAGCGCAAGATGACGCAGGCGCGCATAGAGCGCTCCAAGATGCGCAGACAGAAGGCCAACGCCAGGGAGCGCACACGCATGCACGACCTCAACTCGGCTCTGGACAACCTGCGCAAAGTGGTGCCCTGTTACTCCAAAACGCAAAAACTATCCAAAATAGAGACACTGCGGCTGGCTAAAAACTACATTTGGGCCCTGTCCGAGATCCTGCGCTCGGGGAAAAGGCCAGATCTTGTCTCCTACGTGCAGACTTTATGCAAAGGCCTCTCCCAGCCCACCACCAACCTGGTGGCTGGTTGTCTGCAGCTCAACTCCAGGAACTTCTTAACCGAGCAGTGCCAGGAGGGAGGTCGGTTCCACGGTCCCAACTCGTCCTTCTCCATGCATCCCTACCCCTATCAGTGCTCCCGGCTCTCCAGTCCCCAGTGCCAATCCGGCTCCATGCCTAACTCGCACCCTCTAAGGACCCATGCGTACTGCTCCACCTACGAGTCTCTCTACACCGGGAACGCCTCCCCAGAGTACAACAGCTCGGAGTACGAGGGTCCACTAAGCCCGCCGCTGTGCATCAACGGCAATTTCTCCCTGAAGCAACAGGACTCTGCCGCCTCGCCCGACGCGGAGAAAAGCTACCACTACTCTATGCACTACTCGGCGCTGCCCAGCTCCCGGCCCGCGGCGCACAGCCTGGTGTTCGGCTCGTCCAGCGGCCGCGGCGCCGTGCACTCCGACAACGTGCTGCCTTACCACGACATGCACCTGCACCACGACAGGGCGCCCATGTACGAGGAGCTCAACGCGTTTTTCCACAACTGA

Function

symbol description
neurod2 Predicted to enable DNA-binding transcription factor activity, RNA polymerase II-specific and RNA polymerase II cis-regulatory region sequence-specific DNA binding activity. Predicted to be involved in neuron differentiation and regulation of transcription by RNA polymerase II. Predicted to act upstream of or within several processes, including regulation of neuron differentiation; regulation of synapse maturation; and regulation of transcription, DNA-templated. Predicted to be active in nucleus. Is expressed in granule cell. Human ortholog(s) of this gene implicated in developmental and epileptic encephalopathy 72. Orthologous to human NEUROD2 (neuronal differentiation 2).

NR:

description
PREDICTED: neurogenic differentiation factor 2

GO: NA

KEGG:

id description
K09078 NEUROD2; neurogenic differentiation factor 2

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00016601 True 1101 mRNA 0.60 1 25824746 25825846

Neighbor

gene id symbol gene type direction distance location
AMCG00016599 med1 coding downstream 98199 25706081 ~ 25726547 (-)
AMCG00016600 fbxl20,LOC107727724,LOC107666314,LOC107665129,LOC107549884,LOC107563017 coding downstream 121419 25676569 ~ 25703327 (-)
AMCG00016597 NA coding downstream 182413 25611563 ~ 25642333 (-)
AMCG00016594 cacnb1,LOC106600985,LOC103392742 coding downstream 341036 25449909 ~ 25483710 (-)
AMCG00016596 NA coding downstream 374994 25439336 ~ 25449752 (-)
AMCG00016614 NA coding upstream 279070 26104916 ~ 26117450 (-)
AMCG00016615 NA coding upstream 325765 26151611 ~ 26155450 (-)
AMCG00016624 LOC107733370 coding upstream 386540 26212386 ~ 26215060 (-)
AMCG00016629 LOC108438403 coding upstream 479069 26304915 ~ 26309363 (-)
AMCG00016628 NA coding upstream 513647 26339493 ~ 26343614 (-)
G14517 NA non-coding downstream 149546 25672304 ~ 25675200 (-)
G14507 NA non-coding downstream 215687 25604780 ~ 25609059 (-)
G14496 NA non-coding downstream 279021 25543046 ~ 25545725 (-)
G14487 rpl19,LOC101068736,LOC103368168 non-coding downstream 304650 25516989 ~ 25520096 (-)
G14472 NA non-coding downstream 419645 25404895 ~ 25405101 (-)
G14578 NA non-coding upstream 92184 25918030 ~ 25921548 (-)
G14585 NA non-coding upstream 145940 25971786 ~ 26022263 (-)
G14587 NA non-coding upstream 147688 25973534 ~ 25979563 (-)
G14650 NA non-coding upstream 271882 26097728 ~ 26098972 (-)
G14723 NA non-coding upstream 449331 26275177 ~ 26303459 (-)
G14534 NA other downstream 70274 25752995 ~ 25754472 (-)
AMCG00016591 NA other downstream 404375 25413316 ~ 25420371 (-)
AMCG00016579 NA other downstream 547268 25264772 ~ 25277478 (-)
G14392 NA other downstream 741047 25080568 ~ 25083699 (-)
AMCG00016562 rnf6 other downstream 809403 25007974 ~ 25015343 (-)
G14637 NA other upstream 255657 26081503 ~ 26083167 (-)
AMCG00016617 NA other upstream 321664 26147510 ~ 26149543 (-)
AMCG00016616 sp6,LOC102212756,LOC101463567,LOC100707362,LOC107396441,LOC106564946,LOC103384358 other upstream 330675 26156521 ~ 26159922 (-)
G14676 NA other upstream 355898 26181744 ~ 26184778 (-)
AMCG00016623 NA other upstream 413236 26239082 ~ 26241390 (-)

Expression


Co-expression Network