AMCG00016682 (igf2bp1,LOC108412303,LOC107585078,LOC107740658,LOC107717213)


Basic Information

Item Value
gene id AMCG00016682
gene name igf2bp1,LOC108412303,LOC107585078,LOC107740658,LOC107717213
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030122.1
NCBI id CM030122.1
chromosome length 54868152
location 27450004 ~ 27451999 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00016682
ATGAACAAGCTCTACATTGGAAATCTGAGCGAAAACGTGACTCCAGAAGACTTGATCAAAGTCTTTGAAGACTGCAAGATCCCATTCTCGGGTCAGTTTCTATTGAAAACCGGGTACGCATTCGTTGACTGTCCGGACGACCAATGGGCAATTAAAGCGATCGAGACATTTTCTGGCAAAGTGGAACTTCATGGCAAACGTATAGAAGTCGAACATTCTGTCCCTAAGAAGCAG

Function

symbol description
igf2bp1 Predicted to enable mRNA 3'-UTR binding activity. Acts upstream of or within neural retina development. Predicted to be located in several cellular components, including filopodium; growth cone; and lamellipodium. Predicted to be part of CRD-mediated mRNA stability complex. Predicted to be active in cytosol and nucleus. Is expressed in diencephalic white matter and head. Orthologous to human IGF2BP1 (insulin like growth factor 2 mRNA binding protein 1).

NR:

description
PREDICTED: insulin-like growth factor 2 mRNA-binding protein 1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00016682 True 234 mRNA 0.44 2 27450004 27451999

Neighbor

gene id symbol gene type direction distance location
AMCG00016679 NA coding upstream 22970 27425680 ~ 27427034 (+)
AMCG00016678 NA coding upstream 33994 27414210 ~ 27416010 (+)
AMCG00016676 atp5g1,LOC107740625,LOC106600830 coding upstream 40083 27406731 ~ 27409921 (+)
AMCG00016680 NA coding upstream 44276 27405408 ~ 27405728 (+)
AMCG00016677 NA coding upstream 46082 27393958 ~ 27403922 (+)
AMCG00016686 LOC101072148 coding downstream 32634 27484633 ~ 27496345 (+)
AMCG00016684 NA coding downstream 53190 27505189 ~ 27508236 (+)
AMCG00016685 NA coding downstream 76827 27528826 ~ 27538723 (+)
AMCG00016687 rapgefl1 coding downstream 124534 27576533 ~ 27584981 (+)
AMCG00016689 NA coding downstream 155217 27607216 ~ 27610772 (+)
G15025 NA non-coding upstream 79866 27369589 ~ 27370138 (+)
G15005 hoxb7a,hxb7a,hoxb7,hoxb7ab non-coding upstream 167435 27281424 ~ 27282569 (+)
G14992 NA non-coding upstream 175707 27262890 ~ 27274297 (+)
G14803 NA non-coding upstream 734203 26715569 ~ 26715801 (+)
G14802 NA non-coding upstream 736875 26712231 ~ 26713129 (+)
G15224 NA non-coding downstream 664919 28116918 ~ 28117190 (+)
G15226 NA non-coding downstream 666544 28118543 ~ 28119649 (+)
G15253 NA non-coding downstream 708666 28160665 ~ 28160887 (+)
G15270 NA non-coding downstream 773843 28225842 ~ 28230979 (+)
G15328 NA non-coding downstream 982985 28434984 ~ 28435256 (+)
AMCG00016663 NA other upstream 456056 26966297 ~ 26993948 (+)
AMCG00016635 NA other upstream 792579 26600093 ~ 26657425 (+)
AMCG00016638 krt222 other upstream 901792 26527319 ~ 26548212 (+)
AMCG00016640 NA other upstream 950762 26489938 ~ 26499242 (+)
AMCG00016633 NA other upstream 1016348 26427339 ~ 26433656 (+)
AMCG00016683 NA other downstream 90487 27542486 ~ 27553120 (+)
AMCG00016691 NA other downstream 136480 27588479 ~ 27604879 (+)
AMCG00016690 NA other downstream 161106 27613105 ~ 27626090 (+)
AMCG00016699 LOC106607176 other downstream 325428 27777427 ~ 27799126 (+)
AMCG00016705 NA other downstream 377269 27829268 ~ 27833537 (+)

Expression


Co-expression Network