AMCG00016727


Basic Information

Item Value
gene id AMCG00016727
gene name NA
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030122.1
NCBI id CM030122.1
chromosome length 54868152
location 28509826 ~ 28518748 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00016727
TTATTCTGCAATACGTCTATAGATGGAATAGGGACCTGTTGGCCCAAAAGCAACGCTGGGGAGTTGGTGTCCCGACCTTGTCCTGAGTACTTCTATGGAGTCCGATACAACACTACAAACAATGTGTACAGGGAATGCCTCTCCAATGGGACCTGGGCAATGAAGGGCAATTATTCACAATGCCAAGCAATTCTGAATGAA

Function

GO: NA

KEGG:

id description
ko04512 ECM-receptor interaction
ko04510 Focal adhesion
ko04974 Protein digestion and absorption

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00016727 True 201 mRNA 0.46 2 28509826 28518748

Neighbor

gene id symbol gene type direction distance location
AMCG00016726 LOC105890724,LOC107754311,LOC108413653,LOC108261365,LOC107694956 coding downstream 17210 28477514 ~ 28492616 (-)
AMCG00016725 cdc27,LOC106600875 coding downstream 89916 28405721 ~ 28419910 (-)
AMCG00016723 NA coding downstream 122134 28386229 ~ 28387692 (-)
AMCG00016724 NA coding downstream 152046 28350369 ~ 28357780 (-)
AMCG00016718 NA coding downstream 237281 28264344 ~ 28272545 (-)
AMCG00016733 s2540,LOC106601558,LOC108434938 coding upstream 206861 28725609 ~ 28738603 (-)
AMCG00016736 dlx3,dlx3b coding upstream 430702 28949450 ~ 28953796 (-)
AMCG00016738 NA coding upstream 502879 29021627 ~ 29024518 (-)
AMCG00016741 NA coding upstream 672986 29191734 ~ 29201720 (-)
AMCG00016743 nsf,LOC107601245,LOC108260232,LOC107688085 coding upstream 747011 29265759 ~ 29288483 (-)
G15330 NA non-coding downstream 58194 28451398 ~ 28451632 (-)
G15291 NA non-coding downstream 223381 28284362 ~ 28286445 (-)
G15254 NA non-coding downstream 348886 28160687 ~ 28160940 (-)
G15228 NA non-coding downstream 451763 28003239 ~ 28058063 (-)
G15206 col1a1,LOC105005744,LOC107585052,LOC107740634,LOC104944135,LOC103393603,LOC108233705,LOC107582926,LOC102798806 non-coding downstream 521397 27979546 ~ 27988429 (-)
G15364 NA non-coding upstream 163090 28681838 ~ 28682338 (-)
G15365 fam171a2,LOC106600878,LOC106607454 non-coding upstream 176950 28695698 ~ 28695920 (-)
G15448 NA non-coding upstream 547363 29066111 ~ 29066388 (-)
G15525 NA non-coding upstream 742564 29261312 ~ 29264667 (-)
G15585 NA non-coding upstream 1284147 29802895 ~ 29807133 (-)
AMCG00016712 NA other downstream 352626 28130012 ~ 28157200 (-)
G15076 NA other downstream 1081175 27424893 ~ 27428651 (-)
G15067 NA other downstream 1105904 27401676 ~ 27403922 (-)
G15026 NA other downstream 1139687 27369590 ~ 27370139 (-)
AMCG00016671 hoxb6ab,hoxb6,hoxb6a,LOC105013254,LOC103045875,LOC107582892 other downstream 1230492 27265887 ~ 27279334 (-)
AMCG00016732 NA other upstream 262724 28781472 ~ 28785507 (-)
AMCG00016740 ormdl3,LOC108273759,LOC107723636,LOC107657273,LOC107556587,LOC102217224,LOC106521946 other upstream 683124 29201872 ~ 29225587 (-)
G15706 NA other upstream 1682711 30201459 ~ 30202351 (-)
G15787 NA other upstream 2007544 30526292 ~ 30529500 (-)
AMCG00016815 NA other upstream 2861799 31380547 ~ 31388268 (-)

Expression


Co-expression Network