AMCG00016736 (dlx3,dlx3b)


Basic Information

Item Value
gene id AMCG00016736
gene name dlx3,dlx3b
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030122.1
NCBI id CM030122.1
chromosome length 54868152
location 28949450 ~ 28953796 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00016736
ATGATGAGCGGACCGACTTTCGAGAAGAAGATATCGAGCATTTTAAGCGACCTGCCCGGTTCTATGGGTTGTCACCCGGCTTCCAAAGACTCCCCGACCCTGCCCGAGTCCACCGCCACGGACATGGGCTACTACAGCGGACAGACGACGCACAGCCAACACGAGTACTACCAGAGCCAGTCCTACTCCCAGCCCATGAACCCGTACACGTATCACCAGTTCAACCTCAGTGGCATGGGGAGTGCGGGGGCCTACCCCACGAAATCAGAATACCCCTACTCCAATTCTTACAGGCCATACGGACACTACAACAGGGACGTACAGACGCCACCACAAGACATAGTTAAAGAGGAACCCGAGCCCGAAGTCCGGATGGTGAATGGAAAACCCAAGAAAATACGCAAACCCCGGACCATCTACTCCAGCTACCAGCTCGCCGCGCTGCAGAGGCGCTTCCAGAAGGCGCAGTACCTGGCCCTGCCCGAGCGAGCGGAGCTGGCGGCGCAGCTGGGCTTGACGCAGACACAGGTGAAAATCTGGTTTCAAAACCGGCGCTCCAAGTTCAAGAAGCTGTACAAGAACGGCGAGGTCCCTCTGGAACACAGCCCGAACGCCAGCGACTCCATGGCCTGCAACTCCCCGCCCTCCCCGGCGGTCTGGGACAGTTCCTCCCACCCCAACCCCGCCACTAGGGGGCAGCTACAACAACCTCCTCTCAGCTCCTCGCCCACATACATGGAGGACTATAGCAATCACTGGTACCAGCAGGGCTCCCATCTACAACACCCGGGCTCCGTACACCATACACCCCCGCCGCAAAGTATGGGTGCGGTGTATTGA

Function

symbol description
dlx3b Enables sequence-specific DNA binding activity. Acts upstream of or within several processes, including sensory organ development; skeletal system development; and trigeminal nerve development. Predicted to be located in nucleus. Is expressed in several structures, including ectoderm; neural plate; neurogenic field; pharyngeal arch; and presumptive structure. Human ortholog(s) of this gene implicated in amelogenesis imperfecta type 4 and trichodontoosseous syndrome. Orthologous to human DLX3 (distal-less homeobox 3).
dlx3 Enables sequence-specific double-stranded DNA binding activity. Predicted to be involved in epithelial cell differentiation and regulation of transcription by RNA polymerase II. Predicted to act upstream of or within several processes, including odontoblast differentiation; odontogenesis of dentin-containing tooth; and placenta development. Predicted to be located in nucleus. Predicted to be part of chromatin. Implicated in amelogenesis imperfecta type 4 and trichodontoosseous syndrome.

NR:

description
PREDICTED: homeobox protein DLX-3

GO:

id name namespace
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0005634 nucleus cellular_component
GO:0003700 DNA-binding transcription factor activity molecular_function
GO:0000976 transcription regulatory region sequence-specific DNA binding molecular_function

KEGG:

id description
K09315 DLX3; homeobox protein DLX3

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00016736 True 840 mRNA 0.59 3 28949450 28953796

Neighbor

gene id symbol gene type direction distance location
AMCG00016733 s2540,LOC106601558,LOC108434938 coding downstream 210847 28725609 ~ 28738603 (-)
AMCG00016727 NA coding downstream 430702 28509826 ~ 28518748 (-)
AMCG00016726 LOC105890724,LOC107754311,LOC108413653,LOC108261365,LOC107694956 coding downstream 456834 28477514 ~ 28492616 (-)
AMCG00016725 cdc27,LOC106600875 coding downstream 529540 28405721 ~ 28419910 (-)
AMCG00016723 NA coding downstream 561758 28386229 ~ 28387692 (-)
AMCG00016738 NA coding upstream 67831 29021627 ~ 29024518 (-)
AMCG00016741 NA coding upstream 237938 29191734 ~ 29201720 (-)
AMCG00016743 nsf,LOC107601245,LOC108260232,LOC107688085 coding upstream 311963 29265759 ~ 29288483 (-)
AMCG00016742 LOC104926834,LOC100703712,LOC108442534,LOC107688086,LOC107709998,LOC107601249 coding upstream 359592 29313388 ~ 29322785 (-)
AMCG00016744 myo1d,LOC107743773,LOC107677861,LOC106908042 coding upstream 402396 29356192 ~ 29362007 (-)
G15365 fam171a2,LOC106600878,LOC106607454 non-coding downstream 253530 28695698 ~ 28695920 (-)
G15364 NA non-coding downstream 267112 28681838 ~ 28682338 (-)
G15330 NA non-coding downstream 497818 28451398 ~ 28451632 (-)
G15291 NA non-coding downstream 663005 28284362 ~ 28286445 (-)
G15254 NA non-coding downstream 788510 28160687 ~ 28160940 (-)
G15448 NA non-coding upstream 112315 29066111 ~ 29066388 (-)
G15525 NA non-coding upstream 307516 29261312 ~ 29264667 (-)
G15585 NA non-coding upstream 849099 29802895 ~ 29807133 (-)
G15673 psme3,LOC106589310,LOC107706898,LOC107669474 non-coding upstream 1084994 30038790 ~ 30041875 (-)
G15675 NA non-coding upstream 1088779 30042575 ~ 30044565 (-)
AMCG00016732 NA other downstream 163943 28781472 ~ 28785507 (-)
AMCG00016712 NA other downstream 792250 28130012 ~ 28157200 (-)
G15076 NA other downstream 1520799 27424893 ~ 27428651 (-)
G15067 NA other downstream 1545528 27401676 ~ 27403922 (-)
G15026 NA other downstream 1579311 27369590 ~ 27370139 (-)
AMCG00016740 ormdl3,LOC108273759,LOC107723636,LOC107657273,LOC107556587,LOC102217224,LOC106521946 other upstream 248076 29201872 ~ 29225587 (-)
G15706 NA other upstream 1247663 30201459 ~ 30202351 (-)
G15787 NA other upstream 1572496 30526292 ~ 30529500 (-)
AMCG00016815 NA other upstream 2426751 31380547 ~ 31388268 (-)
AMCG00016847 NA other upstream 3307753 32261549 ~ 32267968 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
zebrafish (Danio rerio) XLOC_004505 dlx3b coding NC_007123.7 CM002896.2 5708400 ~ 5711920 (+)
grasscarp (Ctenopharyngodon idella) CI01000047_02747442_02755248 DLX3B coding CI01000047 null 2746901 ~ 2755248 (-)