AMCG00016802 (LOC105013322)


Basic Information

Item Value
gene id AMCG00016802
gene name LOC105013322
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030122.1
NCBI id CM030122.1
chromosome length 54868152
location 31060351 ~ 31060686 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00016802
ATGAACGGGACCTTTTTCAACCATTCAGTCATCGCACAGGGCATCTTCGGCAACAAAAGCCAGGACCTGGCCGGCTCCCTGGTGGACTGCTGCAACGGGACCGCGGTGACGGCCAACGACGGGAGCTCCCTGGTCCTGGTTCCGGACGAGCGCAGTCTCTTCATCATGCGGGTGGTGCAAATAGCGGTGCTGTGCGTCCTCTCCTTGACTGTCATTTTCGGCATCTTCTTTCTGGGCTGCAACCTCATGATCAAATCCGAAAGCATGATCAACTTTCTGGTGAAAGACCGGAGACCTTCCAAAGATGTAGAAGCGGTCATCATTGGCCTTAACTAG

Function

NR:

description
PREDICTED: reprimo-like protein

GO:

id name namespace
GO:0016021 integral component of membrane cellular_component

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00016802 True 336 mRNA 0.55 1 31060351 31060686

Neighbor

gene id symbol gene type direction distance location
AMCG00016800 NA coding downstream 44381 31012563 ~ 31015970 (-)
AMCG00016801 psmc5,LOC107753303,LOC107745657,LOC106579096 coding downstream 51925 31003106 ~ 31008426 (-)
AMCG00016793 NA coding downstream 496757 30558256 ~ 30563594 (-)
AMCG00016792 NA coding downstream 502559 30551128 ~ 30557792 (-)
AMCG00016794 NA coding downstream 592547 30465157 ~ 30467804 (-)
AMCG00016807 becn1,LOC102786760 coding upstream 116870 31177556 ~ 31183301 (-)
AMCG00016812 NA coding upstream 231596 31292282 ~ 31315388 (-)
AMCG00016811 NA coding upstream 275759 31336445 ~ 31337280 (-)
AMCG00016816 NA coding upstream 340131 31400817 ~ 31403944 (-)
AMCG00016823 nmt1,LOC102778525 coding upstream 583170 31643856 ~ 31653933 (-)
G15854 NA non-coding downstream 27031 31033070 ~ 31033320 (-)
G15845 NA non-coding downstream 58223 30998634 ~ 31002128 (-)
G15746 NA non-coding downstream 628353 30429929 ~ 30431998 (-)
G15716 NA non-coding downstream 823484 30233548 ~ 30236867 (-)
G15711 NA non-coding downstream 851814 30207687 ~ 30208537 (-)
G15864 NA non-coding upstream 42693 31103379 ~ 31106792 (-)
G15890 NA non-coding upstream 111499 31172185 ~ 31176602 (-)
G15927 NA non-coding upstream 309394 31370080 ~ 31379449 (-)
G15947 phb,LOC107661032 non-coding upstream 360058 31420744 ~ 31421968 (-)
G15962 NA non-coding upstream 416157 31476843 ~ 31481401 (-)
G15787 NA other downstream 530851 30526292 ~ 30529500 (-)
G15706 NA other downstream 858000 30201459 ~ 30202351 (-)
AMCG00016740 ormdl3,LOC108273759,LOC107723636,LOC107657273,LOC107556587,LOC102217224,LOC106521946 other downstream 1834764 29201872 ~ 29225587 (-)
AMCG00016732 NA other downstream 2274844 28781472 ~ 28785507 (-)
AMCG00016712 NA other downstream 2903151 28130012 ~ 28157200 (-)
AMCG00016815 NA other upstream 319861 31380547 ~ 31388268 (-)
AMCG00016847 NA other upstream 1200863 32261549 ~ 32267968 (-)
G16247 NA other upstream 1362372 32423058 ~ 32423438 (-)
AMCG00016859 NA other upstream 1436821 32497507 ~ 32507319 (-)
G16356 fzd2,LOC107583044,LOC107658461,LOC107729561,LOC106607305,LOC106601035 other upstream 2115390 33176076 ~ 33178883 (-)

Expression


Co-expression Network