AMCG00016813 (phb,LOC107661032)


Basic Information

Item Value
gene id AMCG00016813
gene name phb,LOC107661032
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030122.1
NCBI id CM030122.1
chromosome length 54868152
location 31417981 ~ 31420976 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00016813
ACCAACATGGCAAAACTATTTGAAGCAATAGGCAAGCTTGGCCTGGGATTGGCTGTCGTCGGTGGGGTGGTCAACTCTGCCTTGTATAATGTGGACGCTGGGCACCGCGCTGTGATCTTTGACCGCTTCCGAGGCGTGCAGGACGTGGTGGTGGGAGAGGGCACACACTTTCTCGTTCCCTGGGTCCAGAAGCCAATCATCTTCGACTGCCGGTCTCGCCCCCGCAATGTGCCTGTGATCACAGGCAGCAAAGATCTCCAGAACGTGAACATCACCCTGAGGATCCTGTTCAGACCGGTCGCTGGCCAGCTGCCCCGCATCTTCACCAGCATCGGCGAGGACTACGATGAGAGGGTCCTGCCCTCCATCACCACTGAGGTCCTCAAGTCTGTGGTGGCTCGGTTCGATGCTGGTGAGCTGATCACACAGAGAGAGCTGGTGTCACGGCAGGTCAGCGAGGACCTCACAGAGAGAGCCTCAACCTTCGGCCTGATCCTCGACGATGTCTCCCTGACTCACCTGACATTCGGGAAAGAGTTCACGGAGGCTGTGGAGATGAAGCAGGTGGCCCAGCAAGAGGCTGAACGGGCGCGGTTTGTCGTGGAGAAGGCTGAGCAGCAGAAGCAGGCAACCATCATCTCAGCCGAGGGTGACTCCCAGGCCGCCCTGCTGATTGCCAACTCCCTGGCCACGGCGGGAGACGGGCTGGTGGAGCTGCGTAAACTCGAGGCCGCCGAGGACATTGTCTTCCAGCTGTCCCGCTCCCGCAACGTCACCTACCTGCCTTCCGGCCAGGGGACCCTGCTGCAGCTGCCCCAGTGA

Function

symbol description
phb Predicted to be involved in mitochondrion organization. Predicted to be located in mitochondrial inner membrane and plasma membrane. Predicted to be active in mitochondrion. Is expressed in several structures, including alar plate midbrain region; digestive system; immature eye; midbrain; and musculature system. Human ortholog(s) of this gene implicated in breast cancer and sporadic breast cancer. Orthologous to human PHB (prohibitin).

NR:

description
prohibitin isoform X1

GO:

id name namespace
GO:0016020 membrane cellular_component

KEGG:

id description
K17080 PHB1; prohibitin 1

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00016813 True 822 mRNA 0.60 6 31417981 31420976

Neighbor

gene id symbol gene type direction distance location
AMCG00016814 NA coding upstream 5928 31393171 ~ 31412053 (+)
AMCG00016809 NA coding upstream 47632 31363835 ~ 31370349 (+)
AMCG00016810 LOC105013316,LOC108413532,LOC106607262 coding upstream 66805 31344014 ~ 31351176 (+)
AMCG00016808 NA coding upstream 187186 31183690 ~ 31230795 (+)
AMCG00016806 NA coding upstream 241444 31142408 ~ 31176537 (+)
AMCG00016819 znf652,LOC108258819 coding downstream 26143 31447119 ~ 31467459 (+)
AMCG00016817 NA coding downstream 72276 31493252 ~ 31503016 (+)
AMCG00016818 eftud2,LOC102798265 coding downstream 86575 31507551 ~ 31523662 (+)
AMCG00016826 NA coding downstream 145926 31566902 ~ 31569427 (+)
AMCG00016822 NA coding downstream 159166 31580142 ~ 31591537 (+)
G15853 NA non-coding upstream 384660 31033069 ~ 31033321 (+)
G15847 psmc5,LOC107745657,LOC107684752 non-coding upstream 410975 31005897 ~ 31007006 (+)
G15817 NA non-coding upstream 511142 30905610 ~ 30906839 (+)
G15730 NA non-coding upstream 986187 30429053 ~ 30431794 (+)
G15651 NA non-coding upstream 1202271 30213172 ~ 30215710 (+)
G15961 NA non-coding downstream 54331 31475307 ~ 31476218 (+)
G15966 NA non-coding downstream 83103 31504079 ~ 31504552 (+)
G15995 NA non-coding downstream 194244 31615220 ~ 31644515 (+)
G16037 NA non-coding downstream 334066 31755042 ~ 31755427 (+)
G16169 NA non-coding downstream 840735 32261711 ~ 32262672 (+)
G15855 LOC105013322 other upstream 356836 31059340 ~ 31061145 (+)
G15659 NA other upstream 1181140 30236454 ~ 30236841 (+)
AMCG00016770 rpl27,LOC106601555,LOC107551168 other upstream 1304697 30109599 ~ 30113284 (+)
AMCG00016769 NA other upstream 1310254 30022607 ~ 30107727 (+)
AMCG00016820 NA other downstream 52730 31473706 ~ 31493104 (+)
AMCG00016829 NA other downstream 280693 31701669 ~ 31731446 (+)
AMCG00016830 NA other downstream 307580 31728556 ~ 31751113 (+)
AMCG00016841 NA other downstream 830832 32251808 ~ 32260627 (+)
AMCG00016854 NA other downstream 1078080 32499056 ~ 32503372 (+)

Expression


Co-expression Network