AMCG00016887 (kcnh6a,LOC106601567,LOC105012970,LOC108427397,LOC106527280)


Basic Information

Item Value
gene id AMCG00016887
gene name kcnh6a,LOC106601567,LOC105012970,LOC108427397,LOC106527280
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030122.1
NCBI id CM030122.1
chromosome length 54868152
location 33381884 ~ 33390755 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00016887
ATGCCAGTGAGACGGGGCCATGTAGCGCCCCAGAACACCTACCTGGACACCATTATCAGGAAATTCGAAGGACAAAGCCGCAAGTTCCTGATTGCCAATGCCCAGATGAAGAACTGCGGCATCATCTACTGCAACGAGGGCTTTTGCCAGATGTTCGGCTTCTCGCGAGCAGAGATCATGCAGCAGCCCTGCACCTGCCCCTTCCTGGTGGGGCCTGGCACCATGAAGACTGCTGTGGCGCAGCTGGCACAGGCCCTGCTGGGCTCTGAGGAAAGAAAAGTGGAGATCCTGTACTACTCCAAGGAG

Function

symbol description
kcnh6a Enables voltage-gated potassium channel activity. Acts upstream of or within several processes, including heart contraction; membrane repolarization during cardiac muscle cell action potential; and regulation of ventricular cardiac muscle cell membrane repolarization. Predicted to be integral component of membrane. Predicted to be integral component of plasma membrane. Is expressed in several structures, including cardiovascular system; digestive system; gill; immune system; and muscle. Used to study long QT syndrome; long QT syndrome 2; and short QT syndrome. Orthologous to human KCNH6 (potassium voltage-gated channel subfamily H member 6).

NR:

description
PREDICTED: potassium voltage-gated channel subfamily H member 6-like

GO:

id name namespace
GO:0071805 potassium ion transmembrane transport biological_process
GO:0008016 regulation of heart contraction biological_process
GO:0060307 regulation of ventricular cardiac muscle cell membrane repolarization biological_process
GO:0007165 signal transduction biological_process
GO:0005887 integral component of plasma membrane cellular_component
GO:0004871 obsolete signal transducer activity molecular_function
GO:0005249 voltage-gated potassium channel activity molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00016887 True 306 mRNA 0.57 2 33381884 33390755

Neighbor

gene id symbol gene type direction distance location
AMCG00016888 NA coding downstream 33822 33333462 ~ 33348062 (-)
AMCG00016884 ccdc47,LOC107674171,LOC107658463,LOC107729550,LOC107721963 coding downstream 63302 33307741 ~ 33318582 (-)
AMCG00016879 NA coding downstream 186628 33191702 ~ 33195256 (-)
AMCG00016877 pus3 coding downstream 209951 33168630 ~ 33171933 (-)
AMCG00016878 NA coding downstream 220925 33155283 ~ 33160959 (-)
AMCG00016893 map3k3,LOC102777599 coding upstream 48797 33439552 ~ 33473811 (-)
AMCG00016894 NA coding upstream 83255 33474010 ~ 33479455 (-)
AMCG00016895 NA coding upstream 122872 33513627 ~ 33520074 (-)
AMCG00016892 ddx42 coding upstream 163346 33554101 ~ 33575296 (-)
AMCG00016904 LOC107583088 coding upstream 191969 33582724 ~ 33596242 (-)
G16422 NA non-coding downstream 53543 33325086 ~ 33328341 (-)
G16378 NA non-coding downstream 89635 33292031 ~ 33292249 (-)
G16377 NA non-coding downstream 97657 33284014 ~ 33284227 (-)
G16375 NA non-coding downstream 125502 33255653 ~ 33256382 (-)
G16325 NA non-coding downstream 397420 32984254 ~ 32984464 (-)
G16502 NA non-coding upstream 237345 33628100 ~ 33628919 (-)
G16505 NA non-coding upstream 243372 33634127 ~ 33634339 (-)
G16509 NA non-coding upstream 250443 33641198 ~ 33641979 (-)
G16510 NA non-coding upstream 252223 33642978 ~ 33643661 (-)
G16511 NA non-coding upstream 253454 33644209 ~ 33648440 (-)
G16356 fzd2,LOC107583044,LOC107658461,LOC107729561,LOC106607305,LOC106601035 other downstream 203001 33176076 ~ 33178883 (-)
AMCG00016859 NA other downstream 874565 32497507 ~ 32507319 (-)
G16247 NA other downstream 958446 32423058 ~ 32423438 (-)
AMCG00016847 NA other downstream 1113916 32261549 ~ 32267968 (-)
AMCG00016815 NA other downstream 1993616 31380547 ~ 31388268 (-)
AMCG00016889 LOC107570748,LOC106906011 other upstream 1034 33391789 ~ 33434651 (-)
AMCG00016891 limd2,LOC107674139,LOC107658411 other upstream 97970 33488725 ~ 33513579 (-)
G16563 NA other upstream 715935 34106690 ~ 34107941 (-)
AMCG00016938 NA other upstream 2005237 35395992 ~ 35399030 (-)
G17032 NA other upstream 4367402 37758157 ~ 37758471 (-)

Expression


Co-expression Network