AMCG00016905 (spop)


Basic Information

Item Value
gene id AMCG00016905
gene name spop
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030122.1
NCBI id CM030122.1
chromosome length 54868152
location 33791287 ~ 33801810 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00016905
GTGAGTGTGGTGCAGGACTCGGTGAACATCTCTGGTCAGAATACTATGAACATGGTGAAAGTGCCAGAGTGTCGTCTGGCGGACGAGCTGGGTGGTCTGTGGGAGAACTCGCGCTTCACGGATTGCTCCCTGTGCGTGGCTGGTCAGGAGTTCCAGGCCCACAAAGCCATCCTTGCAGCTCGGTCGCCTGTGTTCAGCGCCATGTTCGAGCATGAAATGGAGGAGAGTAAAAAGAACCGGGTGGAAATCAACGACGTGGAGCCCGAGTATGCCCTGGAGCGTTTGAAGGTGATGTGTGAAGATGCCCTTTGCAGCAATCTGTCAGTGGACAACGCAGCCGAGATCCTGATCCTGGCCGATTTACACAGCGCCGACCAGCTCAAGACACAGGCGGTAGACTTCATTAAC

Function

symbol description
spop Predicted to enable ubiquitin protein ligase binding activity. Predicted to be involved in proteasome-mediated ubiquitin-dependent protein catabolic process and regulation of proteolysis. Predicted to be located in nuclear speck. Predicted to be part of Cul3-RING ubiquitin ligase complex. Predicted to be active in cytoplasm and nucleus. Orthologous to human SPOP (speckle type BTB/POZ protein).

NR:

description
PREDICTED: speckle-type POZ protein

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00016905 True 408 mRNA 0.55 4 33791287 33801810

Neighbor

gene id symbol gene type direction distance location
AMCG00016906 spop,LOC107754841 coding upstream 17754 33761418 ~ 33773533 (+)
AMCG00016897 s35b1,slc35b1,LOC106601597,LOC107590797 coding upstream 128980 33652917 ~ 33662307 (+)
AMCG00016902 NA coding upstream 162998 33625976 ~ 33628289 (+)
AMCG00016896 NA coding upstream 166752 33619292 ~ 33624535 (+)
AMCG00016899 NA coding upstream 173803 33597162 ~ 33617484 (+)
AMCG00016910 NA coding downstream 367678 34169488 ~ 34191749 (+)
AMCG00016913 ptrf,LOC103029568,LOC105905374,LOC105028466,LOC107742253,LOC107664665,LOC103381660 coding downstream 467188 34268998 ~ 34271418 (+)
AMCG00016914 ptrfb,LOC105935706,LOC102209316,LOC102787483,LOC101465061,LOC103482185,LOC103142478 coding downstream 492403 34294213 ~ 34296833 (+)
AMCG00016912 stat3,LOC107653351 coding downstream 509058 34310868 ~ 34340346 (+)
AMCG00016916 NA coding downstream 558417 34360227 ~ 34435938 (+)
G16512 NA non-coding upstream 139998 33651081 ~ 33651289 (+)
G16395 NA non-coding upstream 462945 33325094 ~ 33328342 (+)
G16351 NA non-coding upstream 610848 33180239 ~ 33180439 (+)
G16350 NA non-coding upstream 611347 33179705 ~ 33179940 (+)
G16323 NA non-coding upstream 808957 32981779 ~ 32982330 (+)
G16542 NA non-coding downstream 191372 33993182 ~ 33995382 (+)
G16552 NA non-coding downstream 302646 34104456 ~ 34105687 (+)
G16646 NA non-coding downstream 796012 34597822 ~ 34599917 (+)
G16668 NA non-coding downstream 934527 34736337 ~ 34736549 (+)
G16692 NA non-coding downstream 974015 34775825 ~ 34777047 (+)
AMCG00016901 NA other upstream 116926 33668593 ~ 33674361 (+)
AMCG00016898 NA other upstream 141207 33630012 ~ 33650080 (+)
AMCG00016880 dcaf7,LOC100702343,LOC105030232,LOC105898766 other upstream 457541 33320144 ~ 33333746 (+)
G16289 NA other upstream 933847 32856361 ~ 32857440 (+)
AMCG00016854 NA other upstream 1287915 32499056 ~ 32503372 (+)
G16546 NA other downstream 245561 34047371 ~ 34047720 (+)
AMCG00016909 mien1,LOC107566883,LOC107755209 other downstream 291466 34093276 ~ 34099596 (+)
G16550 NA other downstream 298505 34100315 ~ 34100863 (+)
AMCG00016934 acly,aclya,LOC103369716,LOC108273769 other downstream 1356787 35158597 ~ 35204232 (+)
G17193 NA other downstream 4694241 38496051 ~ 38503632 (+)

Expression


Co-expression Network