AMCG00017017 (slmap,slmapa)


Basic Information

Item Value
gene id AMCG00017017
gene name slmap,slmapa
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030122.1
NCBI id CM030122.1
chromosome length 54868152
location 42066872 ~ 42069674 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00017017
AACCAAACGGAAGACGGGATACGGAAAGAGCTGATCGCCTTACAGGAAGACAAACACAACTACGAGACAACAGCCAAAGAGTCCCTGAGGCGGGTTCTTCAGGAGAAAATCGAGGTGGTCAGGAAGCTGTCTGAAGTGGAGCGGAGTCTTAGTAACACTGAAGATGAATGTACCCACCTGAAGGAGATGAATGAGCGCACGCAGGAAGAGCTGAGGGAGCTGGCGAATAAGTACAACGGAGCTGTGAACGAAATCAAAGACCTTACTGACAAGTTAAAGCTGGCAGAAGGGCGGCAGGAAGAGATCCAGCAGAAGGGGCTGAGTGAGAAGAAGGAGCTGCAGCACCGCATCGATGAGATGGAGGAGAAGGAGCAGGCGTTGCAGGCCCGTATAGAAGCCCTGCAGGCGGACAACGACTTCACCAATGAGCGGCTCACCGCTCTGCAAGGTATTGCCACCAATGCCGCTCAGGCA

Function

symbol description
slmapa Predicted to be involved in protein localization to plasma membrane; regulation of membrane depolarization during cardiac muscle cell action potential; and regulation of voltage-gated sodium channel activity. Predicted to act upstream of or within muscle contraction. Predicted to be located in membrane. Predicted to be integral component of membrane. Orthologous to human SLMAP (sarcolemma associated protein).
slmap Involved in protein localization to plasma membrane; regulation of membrane depolarization during cardiac muscle cell action potential; and regulation of voltage-gated sodium channel activity. Predicted to be located in smooth endoplasmic reticulum. Predicted to be integral component of plasma membrane.

NR:

description
PREDICTED: sarcolemmal membrane-associated protein isoform X5

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00017017 True 474 mRNA 0.54 3 42066872 42069674

Neighbor

gene id symbol gene type direction distance location
AMCG00017010 NA coding upstream 109705 41953747 ~ 41957167 (+)
AMCG00017011 NA coding upstream 114357 41943549 ~ 41952515 (+)
AMCG00017000 NA coding upstream 396495 41658589 ~ 41670377 (+)
AMCG00016996 rnf123,LOC107661915,LOC107726274 coding upstream 570601 41476566 ~ 41496271 (+)
AMCG00016997 rnf123,LOC102204603 coding upstream 602051 41458372 ~ 41464821 (+)
AMCG00017018 NA coding downstream 24737 42094411 ~ 42100315 (+)
AMCG00017022 flnb coding downstream 40355 42110029 ~ 42110696 (+)
AMCG00017021 flnb,LOC107712990,LOC107657976,LOC107680511 coding downstream 87005 42156679 ~ 42210307 (+)
AMCG00017019 NA coding downstream 142935 42212609 ~ 42213383 (+)
AMCG00017020 NA coding downstream 153094 42222768 ~ 42239287 (+)
G17580 NA non-coding upstream 88206 41976395 ~ 41978666 (+)
G17518 NA non-coding upstream 324099 41742350 ~ 41742773 (+)
G17514 NA non-coding upstream 349883 41713810 ~ 41716989 (+)
G17498 NA non-coding upstream 376673 41688010 ~ 41690199 (+)
G17491 NA non-coding upstream 393519 41671378 ~ 41673353 (+)
G17882 NA non-coding downstream 983412 43053086 ~ 43112636 (+)
G17909 NA non-coding downstream 1166146 43235820 ~ 43236036 (+)
G17969 NA non-coding downstream 1324619 43394293 ~ 43394499 (+)
G17988 NA non-coding downstream 1400396 43470070 ~ 43470846 (+)
G17987 LOC107575789 non-coding downstream 1430496 43500170 ~ 43500476 (+)
AMCG00016979 NA other upstream 2812382 39239073 ~ 39254490 (+)
G17193 NA other upstream 3563240 38496051 ~ 38503632 (+)
AMCG00016934 acly,aclya,LOC103369716,LOC108273769 other upstream 6862640 35158597 ~ 35204232 (+)
G16550 NA other upstream 7966009 34100315 ~ 34100863 (+)
AMCG00016909 mien1,LOC107566883,LOC107755209 other upstream 7967276 34093276 ~ 34099596 (+)
G17697 NA other downstream 321623 42391297 ~ 42397787 (+)
AMCG00017078 LOC106565757 other downstream 2056540 44126214 ~ 44137931 (+)
G18192 NA other downstream 2584978 44654652 ~ 44656098 (+)
AMCG00017099 cav3,LOC107673475,LOC107749619,LOC107584510,LOC107577493 other downstream 2879360 44949034 ~ 44961601 (+)
AMCG00017167 NA other downstream 7302348 49372022 ~ 49382218 (+)

Expression


Co-expression Network