AMCG00017035 (klhdc8b,LOC106572099)


Basic Information

Item Value
gene id AMCG00017035
gene name klhdc8b,LOC106572099
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030122.1
NCBI id CM030122.1
chromosome length 54868152
location 42623989 ~ 42630671 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00017035
GGGAAGGTGTATGCCCTGGGAGGGATGGGCTCAGACACGGCGCCCCAGGCTCTGGTGCGAGTCTACGAACCTGCCAAGGACCAGTGGCAGCCCCTGCCCTCCATGCCCACGCCACGATATGGGGCCTCCTCCTTCTCCCGCGGGAACAAGGTCTACGTGCTGGGTGGGAGACAGGGTAAACTTCCTGTCACTGCATTTGAGGCCTTTGACTTGGAAGTGAAAAGCTGGACCCGTTTTCCCTGTATCCCAAGCCGGCGGGCCTTTGCCAGCTGTACCATGACTGACAGATGTTTCTTCAGCCTGGGGGGGCTCCAGCAGCCCGGGCCTCACAACTTCTACTCCCGCCCTCACTTTGTCAGCGCAGTGGAGGTGTATGACACAGAGCTGGGTGAGTCTGGATCTCACAAACTTCAGAAATAA

Function

symbol description
klhdc8b Human ortholog(s) of this gene implicated in Hodgkin's lymphoma. Orthologous to human KLHDC8B (kelch domain containing 8B).

NR:

description
PREDICTED: kelch domain-containing protein 8B

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00017035 True 420 mRNA 0.59 2 42623989 42630671

Neighbor

gene id symbol gene type direction distance location
AMCG00017037 LOC106572099,LOC106566462 coding upstream 29895 42582352 ~ 42594094 (+)
AMCG00017023 NA coding upstream 62333 42553219 ~ 42561656 (+)
AMCG00017028 usp19 coding upstream 72224 42515426 ~ 42551765 (+)
AMCG00017029 LOC106566459,LOC106572101 coding upstream 114361 42477751 ~ 42509628 (+)
AMCG00017027 NA coding upstream 164130 42428197 ~ 42459859 (+)
AMCG00017034 klhdc8b,LOC106572099,LOC106566462 coding downstream 19183 42649854 ~ 42664428 (+)
AMCG00017038 NA coding downstream 85278 42715949 ~ 42719266 (+)
AMCG00017039 NA coding downstream 91806 42722477 ~ 42725222 (+)
AMCG00017043 NA coding downstream 128142 42758813 ~ 42793348 (+)
AMCG00017044 NA coding downstream 165527 42796198 ~ 42809702 (+)
G17580 NA non-coding upstream 645323 41976395 ~ 41978666 (+)
G17518 NA non-coding upstream 881216 41742350 ~ 41742773 (+)
G17514 NA non-coding upstream 907000 41713810 ~ 41716989 (+)
G17498 NA non-coding upstream 933790 41688010 ~ 41690199 (+)
G17491 NA non-coding upstream 950636 41671378 ~ 41673353 (+)
G17882 NA non-coding downstream 422415 43053086 ~ 43112636 (+)
G17909 NA non-coding downstream 605149 43235820 ~ 43236036 (+)
G17969 NA non-coding downstream 763622 43394293 ~ 43394499 (+)
G17988 NA non-coding downstream 839399 43470070 ~ 43470846 (+)
G17987 LOC107575789 non-coding downstream 869499 43500170 ~ 43500476 (+)
G17697 NA other upstream 226202 42391297 ~ 42397787 (+)
AMCG00016979 NA other upstream 3369499 39239073 ~ 39254490 (+)
G17193 NA other upstream 4120357 38496051 ~ 38503632 (+)
AMCG00016934 acly,aclya,LOC103369716,LOC108273769 other upstream 7419757 35158597 ~ 35204232 (+)
G16550 NA other upstream 8523126 34100315 ~ 34100863 (+)
AMCG00017078 LOC106565757 other downstream 1495543 44126214 ~ 44137931 (+)
G18192 NA other downstream 2023981 44654652 ~ 44656098 (+)
AMCG00017099 cav3,LOC107673475,LOC107749619,LOC107584510,LOC107577493 other downstream 2318363 44949034 ~ 44961601 (+)
AMCG00017167 NA other downstream 6741351 49372022 ~ 49382218 (+)
AMCG00017173 NA other downstream 6771860 49402531 ~ 49403845 (+)

Expression


Co-expression Network