AMCG00017063 (mrps25)


Basic Information

Item Value
gene id AMCG00017063
gene name mrps25
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030122.1
NCBI id CM030122.1
chromosome length 54868152
location 43127256 ~ 43128666 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00017063
ATGCCTATGAAAGGAAGGTTCCCCATTAGGAGAACCCTAGAGTATCTCCAGAAAGGGGAGATCGTGTTTAAAAACACGGTGAAGATCATGACGGTTAATTTCAACACGCATGGGGAGCTCAGCGATGGGGCAAGGAAGTTTGTGTTCTTTAACGTCCCTCAAATCCAGTACAAAAACCCTTGGCTCCAGATTGTGATGTTTAAAAACGTGACGCCATCGCCATTCCTAAAGTTCTATCTGGATGATGGTGAGCAGGTCCTGGTGGATGTGGAAGGAAAGGACCATAAACAAATTACCCAGCATGTGCACAAGATCCTGGGCAAAACTCCAGAGGTTCTACAGGCTGAGGAACTGGCGAGAAAGGTAGCTTCCAACCCTGCCAACTTTGGCCCCAAGAAGTACTGTCTGAAGGAGTGCATGTGTGAAGTGGAGGGCCAAGTACCCTGTCCAGCCCTGGTGACCATACCCAAGGAAATGACAGGCAAATACAAGGCAAAGATGAATGCTGCTAAGGACTGA

Function

symbol description
mrps25 Predicted to be a structural constituent of ribosome. Predicted to be located in ribosome. Predicted to be active in mitochondrion. Human ortholog(s) of this gene implicated in combined oxidative phosphorylation deficiency 50. Orthologous to human MRPS25 (mitochondrial ribosomal protein S25).

NR:

description
Mitochondrial 28S ribosomal protein S25

GO: NA

KEGG:

id description
K17404 MRPS25; small subunit ribosomal protein S25

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00017063 True 519 mRNA 0.48 4 43127256 43128666

Neighbor

gene id symbol gene type direction distance location
AMCG00017052 NA coding downstream 125324 43000826 ~ 43001932 (-)
AMCG00017050 tmcc1 coding downstream 190707 42919702 ~ 42936549 (-)
AMCG00017049 plxnd1 coding downstream 222210 42856124 ~ 42905046 (-)
AMCG00017047 NA coding downstream 306516 42816400 ~ 42820740 (-)
AMCG00017048 NA coding downstream 311612 42809776 ~ 42815644 (-)
AMCG00017062 nr2c2 coding upstream 2684 43131350 ~ 43155633 (-)
AMCG00017064 NA coding upstream 26973 43155639 ~ 43270969 (-)
AMCG00017058 NA coding upstream 162659 43291325 ~ 43296289 (-)
AMCG00017057 NA coding upstream 169278 43297944 ~ 43301808 (-)
AMCG00017059 crbn coding upstream 215804 43344470 ~ 43364869 (-)
G17754 NA non-coding downstream 575483 42550325 ~ 42551773 (-)
G17755 NA non-coding downstream 577838 42544360 ~ 42549418 (-)
G17505 NA non-coding downstream 1521861 41601924 ~ 41605395 (-)
G17423 NA non-coding downstream 1882031 41244926 ~ 41245225 (-)
G17414 NA non-coding downstream 2249191 40873372 ~ 40878065 (-)
G17910 NA non-coding upstream 107139 43235805 ~ 43236036 (-)
G18015 NA non-coding upstream 504555 43633221 ~ 43633422 (-)
G18066 NA non-coding upstream 708511 43837177 ~ 43891907 (-)
G18101 NA non-coding upstream 1007522 44136188 ~ 44138542 (-)
G18156 NA non-coding upstream 1248331 44376997 ~ 44377221 (-)
AMCG00017051 NA other downstream 152823 42948991 ~ 42974433 (-)
G17842 NA other downstream 262640 42808711 ~ 42864616 (-)
AMCG00017014 NA other downstream 1188693 41936926 ~ 41938563 (-)
G17421 NA other downstream 1910025 41216651 ~ 41217231 (-)
AMCG00016959 NA other downstream 5068317 37875250 ~ 38058939 (-)
AMCG00017061 NA other upstream 151571 43280237 ~ 43286603 (-)
AMCG00017060 NA other upstream 177031 43305697 ~ 43308626 (-)
AMCG00017067 sumf1 other upstream 505104 43633770 ~ 43659602 (-)
AMCG00017091 brk1,BRK1,LOC106565571 other upstream 1524789 44653455 ~ 44656905 (-)
AMCG00017105 srgap3 other upstream 1989624 45118290 ~ 45161137 (-)

Expression


Co-expression Network