AMCG00017072 (itpr1,LOC102304252,LOC102779610,LOC102203222)


Basic Information

Item Value
gene id AMCG00017072
gene name itpr1,LOC102304252,LOC102779610,LOC102203222
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030122.1
NCBI id CM030122.1
chromosome length 54868152
location 43768858 ~ 43773452 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00017072
CTGGCTCGCCACAATAAGGAGCTGCAGAACATGCTGAAGCCTGGGGGACTGAATGGAGAAGGAGATGAGGCCCTGGAGTTCTATGCCAAACACACGGCCCAGATTGAGATTGTGCGGCATGATCGCACCATGGAGCAAATTGTCTTCCCCGTACCCAACATCTGCGAGTTCCTCACCAACGAATCCAAGCTGAGGGTTTACTATACTACCGAGAGGGACGAGCAAGGCAGCAAGATCAATGACTTCTTCCTCCGGTCAGAAGACCTCTTTAACGAGATGAATTGGCAGAAGAAGCTGCGAGCTCAGCCTGTGTTGTATTGGTGCTCTCGCAACATGTCCTTCTGGAGCAGCATCTCCTTCAACCTGGCTGTGCTCATGAACCTGCTGGTGGCTTTCTTCTATCCCCTGGAGGGCATCCGGGGA

Function

symbol description
itpr1 Enables calcium channel inhibitor activity. Involved in negative regulation of calcium-mediated signaling and response to hypoxia. Located in platelet dense granule membrane and platelet dense tubular network. Implicated in Gillespie syndrome; spinocerebellar ataxia type 15; and spinocerebellar ataxia type 29. Biomarker of Alzheimer's disease.

NR:

description
PREDICTED: inositol 1,4,5-trisphosphate receptor type 1 isoform X7

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00017072 True 423 mRNA 0.53 3 43768858 43773452

Neighbor

gene id symbol gene type direction distance location
AMCG00017073 NA coding upstream 37299 43688060 ~ 43731559 (+)
AMCG00017076 lrrn1,LOC102780565 coding upstream 222054 43544654 ~ 43546804 (+)
AMCG00017065 NA coding upstream 384009 43371658 ~ 43384849 (+)
AMCG00017066 NA coding upstream 399475 43365827 ~ 43369383 (+)
AMCG00017055 NA coding upstream 449545 43317690 ~ 43319313 (+)
AMCG00017071 LOC102304252 coding downstream 7972 43781424 ~ 43795570 (+)
AMCG00017068 NA coding downstream 33512 43806964 ~ 43814318 (+)
AMCG00017069 arl8ba,arl8b,LOC107095653,LOC103137213,LOC107552649 coding downstream 51877 43825329 ~ 43841590 (+)
AMCG00017070 edem1,LOC102794187 coding downstream 69962 43843414 ~ 43855324 (+)
AMCG00017079 NA coding downstream 373260 44146712 ~ 44160471 (+)
G17987 LOC107575789 non-coding upstream 268382 43500170 ~ 43500476 (+)
G17988 NA non-coding upstream 298012 43470070 ~ 43470846 (+)
G17969 NA non-coding upstream 374359 43394293 ~ 43394499 (+)
G17909 NA non-coding upstream 532822 43235820 ~ 43236036 (+)
G17882 NA non-coding upstream 656222 43053086 ~ 43112636 (+)
G18077 NA non-coding downstream 328574 44102026 ~ 44103399 (+)
G18084 NA non-coding downstream 343514 44116966 ~ 44201038 (+)
G18125 NA non-coding downstream 603541 44376993 ~ 44377228 (+)
G18127 NA non-coding downstream 613991 44387443 ~ 44387949 (+)
G18186 NA non-coding downstream 849915 44623367 ~ 44714164 (+)
G17697 NA other upstream 1371071 42391297 ~ 42397787 (+)
AMCG00016979 NA other upstream 4514368 39239073 ~ 39254490 (+)
G17193 NA other upstream 5265226 38496051 ~ 38503632 (+)
AMCG00016934 acly,aclya,LOC103369716,LOC108273769 other upstream 8564626 35158597 ~ 35204232 (+)
G16550 NA other upstream 9667995 34100315 ~ 34100863 (+)
AMCG00017078 LOC106565757 other downstream 352762 44126214 ~ 44137931 (+)
G18192 NA other downstream 881200 44654652 ~ 44656098 (+)
AMCG00017099 cav3,LOC107673475,LOC107749619,LOC107584510,LOC107577493 other downstream 1175582 44949034 ~ 44961601 (+)
AMCG00017167 NA other downstream 5598570 49372022 ~ 49382218 (+)
AMCG00017173 NA other downstream 5629079 49402531 ~ 49403845 (+)

Expression


Co-expression Network