AMCG00017204


Basic Information

Item Value
gene id AMCG00017204
gene name NA
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030122.1
NCBI id CM030122.1
chromosome length 54868152
location 50403319 ~ 50403624 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00017204
ATGAACTTTCTGCGGCGCAGACTTTCAGACAGCAGTTTCATTGCCAACCTGCCCAATGGGTACATGACAGACCTCCAGAGGCCGGAGCCCCAGCAGCCCCCGCCCCCGGCCCCGGCCCCCTCCACGTCCCCTGCCCCGGAGAGGAGGCAGAGCAGCCAGTCCACGGGAAGCGGCTTCTTCAGCTCCATCTCCAATGTGGTGAAGCAGACCGCTGCCTCTGCAGGACTAGTGGAGCAAACCGCCACCGCGGCCAGCAAGAAGTTCAAGGTTCTCCTGATCATCGATGAGCCGCACAACGACTGGTAG

Function

GO:

id name namespace
GO:0071805 potassium ion transmembrane transport biological_process
GO:0051179 localization biological_process
GO:0034220 ion transmembrane transport biological_process
GO:0051234 establishment of localization biological_process
GO:0098655 cation transmembrane transport biological_process
GO:0098660 inorganic ion transmembrane transport biological_process
GO:0098662 inorganic cation transmembrane transport biological_process
GO:0015672 monovalent inorganic cation transport biological_process
GO:0030001 metal ion transport biological_process
GO:0006810 transport biological_process
GO:0006811 ion transport biological_process
GO:0006812 cation transport biological_process
GO:0006813 potassium ion transport biological_process

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00017204 True 306 mRNA 0.62 1 50403319 50403624

Neighbor

gene id symbol gene type direction distance location
AMCG00017198 atg7,LOC107697561,LOC106907352,LOC106911936 coding upstream 99694 50271231 ~ 50303625 (+)
AMCG00017197 NA coding upstream 136170 50265659 ~ 50267149 (+)
AMCG00017196 slc6a1,slc6a1b,LOC107746710,LOC107670967 coding upstream 212539 50178455 ~ 50190780 (+)
AMCG00017193 atp2b2 coding upstream 341954 50045218 ~ 50061365 (+)
AMCG00017194 atp2b2,LOC107561799 coding upstream 371937 50011932 ~ 50031382 (+)
AMCG00017201 syn2,LOC107088169,LOC106904985,LOC102235059,LOC103145103,LOC103467585 coding downstream 37923 50441547 ~ 50445797 (+)
AMCG00017202 syn2,LOC107742035,LOC107571222,LOC107667867 coding downstream 55339 50458963 ~ 50476755 (+)
AMCG00017205 NA coding downstream 97419 50501043 ~ 50513355 (+)
AMCG00017206 NA coding downstream 113418 50517042 ~ 50522542 (+)
AMCG00017207 NA coding downstream 123189 50526813 ~ 50537670 (+)
G19062 NA non-coding upstream 51372 50351252 ~ 50351947 (+)
G19061 NA non-coding upstream 61169 50341417 ~ 50342150 (+)
G19059 NA non-coding upstream 68813 50333760 ~ 50334506 (+)
G19058 NA non-coding upstream 69953 50332466 ~ 50333366 (+)
G19042 LOC103376870 non-coding upstream 247494 50155453 ~ 50155825 (+)
G19146 NA non-coding downstream 227754 50631378 ~ 50631634 (+)
G19152 NA non-coding downstream 236963 50640587 ~ 50640802 (+)
G19195 NA non-coding downstream 324116 50727740 ~ 50728151 (+)
G19245 NA non-coding downstream 733669 51137293 ~ 51138835 (+)
G19275 NA non-coding downstream 892208 51295832 ~ 51296718 (+)
AMCG00017183 NA other upstream 675752 49713467 ~ 49727567 (+)
AMCG00017173 NA other upstream 999474 49402531 ~ 49403845 (+)
AMCG00017167 NA other upstream 1021101 49372022 ~ 49382218 (+)
AMCG00017099 cav3,LOC107673475,LOC107749619,LOC107584510,LOC107577493 other upstream 5441718 44949034 ~ 44961601 (+)
G18192 NA other upstream 5747221 44654652 ~ 44656098 (+)
G19113 NA other downstream 148256 50551880 ~ 50552985 (+)
G19114 raf1,LOC108276324 other downstream 155826 50559450 ~ 50563278 (+)
AMCG00017280 NA other downstream 2410629 52814253 ~ 52817369 (+)
AMCG00017287 NA other downstream 2417437 52821061 ~ 52834042 (+)
G19683 NA other downstream 2932285 53335909 ~ 53339655 (+)

Expression


Co-expression Network