G12359


Basic Information

Item Value
gene id G12359
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030122.1
NCBI id CM030122.1
chromosome length 54868152
location 13627255 ~ 13639150 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU15249
NNNTAGGTTCTGTTTCTGCACTCATTGCGGTCCACATGTTAGAGGACATAGTTGTGACTGGAGTAGTGATTGTTGATGAGCCTACAGTTGTGTTAGGATTGCTAATGGTTTCTGTTGTTCTGGAAATAGTTGAATCAGTGACGGTGGATGTTAATAACATTACACTTTCTGTTTGGGAAGATGAAGATGTTGAGTGATCGGTTGTGTCAGGAGATGACATGGTGCTTGTTACAGTGGAACCTGTAGCTGTTGTGCTGGATTCTAGCATGGCTGAGGTTGACGACATGTTCGTTGTCATTGGCTGGCTGCTTACTGATGTTTCAGGTGTTCCAGTTGTGGTGGTGGCAGGATGTGTGGAAAACTCAGTTGTAGGTGAAATTAGAGATGTTGGAGATGGTGCAGTAGTTTGCAATGTTGTGGAGGATGAAGATTGACTTGTGGTTTCAGTAGTGTTTTGTGAGGAATTTGCTGTTATTATC

Function

GO:

id name namespace
GO:0002011 morphogenesis of an epithelial sheet biological_process
GO:0055113 epiboly involved in gastrulation with mouth forming second biological_process
GO:0090504 epiboly biological_process
GO:0001702 gastrulation with mouth forming second biological_process

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU15249 True 479 lncRNA 0.43 2 13627255 13639150

Neighbor

gene id symbol gene type direction distance location
AMCG00016251 NA coding downstream 32104 13584907 ~ 13595151 (-)
AMCG00016245 NA coding downstream 44589 13562171 ~ 13582666 (-)
AMCG00016247 zgc:112083,LOC108278169,LOC107726099,LOC107662779 coding downstream 84620 13535694 ~ 13542635 (-)
AMCG00016244 NA coding downstream 92280 13522174 ~ 13534975 (-)
AMCG00016248 NA coding downstream 132681 13484337 ~ 13494574 (-)
AMCG00016252 NA coding upstream 15888 13655038 ~ 13675532 (-)
AMCG00016257 wnt11 coding upstream 190610 13829760 ~ 13840039 (-)
AMCG00016258 NA coding upstream 220183 13859333 ~ 13874048 (-)
AMCG00016259 NA coding upstream 235585 13874735 ~ 13879998 (-)
AMCG00016262 NA coding upstream 273772 13912922 ~ 13921956 (-)
G12235 NA non-coding downstream 527031 13097991 ~ 13100224 (-)
G12096 NA non-coding downstream 988557 12638493 ~ 12638698 (-)
G12058 NA non-coding downstream 1235847 12387798 ~ 12391408 (-)
G12046 NA non-coding downstream 1271891 12354675 ~ 12355364 (-)
G12041 NA non-coding downstream 1273874 12353160 ~ 12353381 (-)
G12373 NA non-coding upstream 18293 13657443 ~ 13659659 (-)
G12585 NA non-coding upstream 788475 14427625 ~ 14428817 (-)
G12594 NA non-coding upstream 792462 14431612 ~ 14436531 (-)
G12595 NA non-coding upstream 824467 14463617 ~ 14463823 (-)
G12702 NA non-coding upstream 1554052 15193202 ~ 15193641 (-)
AMCG00016246 prdm15,LOC108413920,LOC102786849 other downstream 68071 13543348 ~ 13559184 (-)
AMCG00016226 NA other downstream 756695 12849878 ~ 12870560 (-)
AMCG00016211 NA other downstream 1298222 12323161 ~ 12329033 (-)
AMCG00016203 zdhhc20,LOC108438268,LOC106578454,LOC108256609 other downstream 1679933 11832428 ~ 11947322 (-)
AMCG00016194 NA other downstream 1845708 11766152 ~ 11781547 (-)
AMCG00016281 NA other upstream 781206 14420356 ~ 14427290 (-)
AMCG00016293 NA other upstream 1146048 14785198 ~ 14791969 (-)
AMCG00016327 NA other upstream 2831461 16470611 ~ 16475170 (-)
G12945 ucp2,ucp2b,LOC106567822 other upstream 3219391 16858541 ~ 16861179 (-)
AMCG00016345 NA other upstream 3227168 16866318 ~ 16870002 (-)

Expression


Co-expression Network