G15075


Basic Information

Item Value
gene id G15075
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030122.1
NCBI id CM030122.1
chromosome length 54868152
location 27424554 ~ 27424821 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU18746
caccgatcagccataacattatgaccacctgcctaatattgtgtaggtccctcttttgccgccaaaacagccctgacccgtcgaggcatggactccactagacctctgaaggtgtgctgtggtatctggcaccaagacgttagcagcagatcctttaagtcctgtaagttgcgaggtggggcctccatggatcggacttgtttgtccagcacatcccacagatgctcgattggattgagatctggggaatttggaggccaagtcaaca

Function

GO:

id name namespace
GO:0009799 specification of symmetry biological_process
GO:0007507 heart development biological_process
GO:0009855 determination of bilateral symmetry biological_process
GO:0007368 determination of left/right symmetry biological_process
GO:0061371 determination of heart left/right asymmetry biological_process

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU18746 True 268 lncRNA 0.52 1 27424554 27424821

Neighbor

gene id symbol gene type direction distance location
AMCG00016675 ttll6,LOC107582749,LOC107727303,LOC107666932 coding downstream 43466 27375965 ~ 27381088 (-)
AMCG00016670 LOC106579309 coding downstream 48854 27370979 ~ 27375700 (-)
AMCG00016669 hoxb13aa,hoxb13ab,hoxb13 coding downstream 84961 27338007 ~ 27339593 (-)
AMCG00016672 hoxb9ab,hoxb9,hoxb9a,LOC106600835 coding downstream 111381 27299603 ~ 27313173 (-)
AMCG00016673 hoxb8,hoxb8ab,hoxb8aa coding downstream 133693 27286874 ~ 27290861 (-)
AMCG00016681 snf8,LOC107734219,LOC107692042,LOC107554070,LOC107584075,LOC107660854 coding upstream 5281 27430102 ~ 27433860 (-)
AMCG00016688 nr1d1,LOC102302421 coding upstream 84824 27509645 ~ 27516973 (-)
AMCG00016692 NA coding upstream 218818 27643639 ~ 27650849 (-)
AMCG00016693 LOC107388104 coding upstream 230927 27655748 ~ 27669412 (-)
AMCG00016694 LOC105013104 coding upstream 276191 27701012 ~ 27707529 (-)
G15074 NA non-coding downstream 8015 27416249 ~ 27416539 (-)
G15073 NA non-coding downstream 8662 27415653 ~ 27415892 (-)
G15071 NA non-coding downstream 11325 27413000 ~ 27413229 (-)
G15066 NA non-coding downstream 25971 27395119 ~ 27398583 (-)
G15016 hoxb9 non-coding downstream 115596 27296085 ~ 27308958 (-)
G15079 NA non-coding upstream 110504 27535325 ~ 27541840 (-)
G15095 NA non-coding upstream 125491 27550312 ~ 27553162 (-)
G15165 NA non-coding upstream 369771 27794592 ~ 27794980 (-)
G15166 NA non-coding upstream 371962 27796783 ~ 27797008 (-)
G15172 NA non-coding upstream 377308 27802129 ~ 27805042 (-)
G15067 NA other downstream 20632 27401676 ~ 27403922 (-)
G15026 NA other downstream 54415 27369590 ~ 27370139 (-)
AMCG00016671 hoxb6ab,hoxb6,hoxb6a,LOC105013254,LOC103045875,LOC107582892 other downstream 145220 27265887 ~ 27279334 (-)
AMCG00016662 cbx1,cbx1b,LOC108279860 other downstream 420847 26995173 ~ 27003707 (-)
AMCG00016644 NA other downstream 781061 26626707 ~ 26643493 (-)
G15076 NA other upstream 72 27424893 ~ 27428651 (-)
AMCG00016712 NA other upstream 705191 28130012 ~ 28157200 (-)
AMCG00016732 NA other upstream 1356651 28781472 ~ 28785507 (-)
AMCG00016740 ormdl3,LOC108273759,LOC107723636,LOC107657273,LOC107556587,LOC102217224,LOC106521946 other upstream 1777051 29201872 ~ 29225587 (-)
G15706 NA other upstream 2776638 30201459 ~ 30202351 (-)

Expression


Co-expression Network