G15422 (thrab,LOC108430158,LOC106579329,LOC107665883)


Basic Information

Item Value
gene id G15422
gene name thrab,LOC108430158,LOC106579329,LOC107665883
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030122.1
NCBI id CM030122.1
chromosome length 54868152
location 29043717 ~ 29043973 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU19179
CCGAGCTCATGAGCAGCACGGCCTGCAGCAGCGCCACTTCCGTGTCGTCCAGGTTGAACTGTGCCAGGCTCTTGCCCAGGTCAAAGATGGCATCCGACACCACACCCAGGCCGCCGTTCTTCAGCTGCTCGCGCTTGACGGCCATCTCCCCGCTCAGCGTCAACGTCTCGCTCTCGGGGTCGTAGCGCACCGCCGCCCGCAGAGACATGATCTCCATGCAGCAGCCCTTCAGCAGGATAATCTGGTCTTCACAAGGC

Function

symbol description
thrab Predicted to enable RNA polymerase II cis-regulatory region sequence-specific DNA binding activity and nuclear receptor activity. Predicted to be involved in cell differentiation; regulation of transcription by RNA polymerase II; and thyroid hormone mediated signaling pathway. Predicted to act upstream of or within regulation of transcription, DNA-templated and retinoic acid receptor signaling pathway. Predicted to be located in nucleus. Is expressed in several structures, including blastodisc; cardiovascular system; mandibular arch skeleton; nervous system; and pleuroperitoneal region. Human ortholog(s) of this gene implicated in congenital nongoitrous hypothyroidism 6 and renal cell carcinoma. Orthologous to human THRA (thyroid hormone receptor alpha).

NR:

description
thyroid hormone receptor alpha B, partial

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU19179 True 257 lncRNA 0.51 1 29043717 29043973

Neighbor

gene id symbol gene type direction distance location
AMCG00016737 NA coding upstream 29575 28999661 ~ 29014142 (+)
AMCG00016735 dlx4b,LOC105899934,LOC106600935,LOC106583890,LOC105028424 coding upstream 114527 28918116 ~ 28929190 (+)
AMCG00016734 myst2,LOC107689642,LOC107554133,LOC106607195 coding upstream 266692 28762024 ~ 28777025 (+)
AMCG00016730 NA coding upstream 325051 28682371 ~ 28718666 (+)
AMCG00016729 NA coding upstream 362216 28664814 ~ 28681501 (+)
AMCG00016745 cdk5r1,LOC108426451 coding downstream 284556 29328529 ~ 29329440 (+)
AMCG00016746 NA coding downstream 325785 29369758 ~ 29371719 (+)
AMCG00016747 NA coding downstream 362142 29406115 ~ 29424802 (+)
AMCG00016759 NA coding downstream 614103 29658076 ~ 29662545 (+)
AMCG00016754 NA coding downstream 618706 29662679 ~ 29670116 (+)
G15417 NA non-coding upstream 4054 28964344 ~ 29039663 (+)
G15346 NA non-coding upstream 314663 28725487 ~ 28729054 (+)
G15329 NA non-coding upstream 592101 28451304 ~ 28451616 (+)
G15328 NA non-coding upstream 608461 28434984 ~ 28435256 (+)
G15270 NA non-coding upstream 812738 28225842 ~ 28230979 (+)
G15424 NA non-coding downstream 13713 29057686 ~ 29058167 (+)
G15425 NA non-coding downstream 22144 29066117 ~ 29066407 (+)
G15450 NA non-coding downstream 100709 29144682 ~ 29179798 (+)
G15457 NA non-coding downstream 155748 29199721 ~ 29201766 (+)
G15460 NA non-coding downstream 167524 29211497 ~ 29211718 (+)
AMCG00016731 NA other upstream 282525 28743360 ~ 28761192 (+)
G15223 NA other upstream 938006 28104737 ~ 28105711 (+)
AMCG00016707 col1a1,LOC100135784,LOC100286406,LOC106600852,LOC105005744 other upstream 1044940 27964578 ~ 27998777 (+)
AMCG00016702 NA other upstream 1165020 27872663 ~ 27878697 (+)
AMCG00016706 LOC102299446 other upstream 1204614 27836513 ~ 27839103 (+)
AMCG00016739 wnt3,LOC103381861,LOC108249203,LOC104961604,LOC104925160,LOC105936264,LOC101174231,LOC100707095,LOC108273758,LOC106589299,LOC101469754 other downstream 190531 29234504 ~ 29256824 (+)
AMCG00016769 NA other downstream 978634 30022607 ~ 30107727 (+)
AMCG00016772 g6pc other downstream 1028965 30072938 ~ 30083528 (+)
AMCG00016770 rpl27,LOC106601555,LOC107551168 other downstream 1065626 30109599 ~ 30113284 (+)
G15659 NA other downstream 1192481 30236454 ~ 30236841 (+)

Expression


Co-expression Network