G15448


Basic Information

Item Value
gene id G15448
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030122.1
NCBI id CM030122.1
chromosome length 54868152
location 29066111 ~ 29066388 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU19205
gatctgcgctgtattagggatatagaagaattggtcaatcagcccatgagagagatggtgtgcacgccaaaacctaggagagttgagaccttagagcaggacagtgtagagaactgctgggttacagtaggtcgtaaccgcagaaaagggcgtgcacaacccctagagacaccccaagagctcagagggtgatgggggggcagttgagcaccagagcaccatggt

Function

NR:

description
PREDICTED: mediator of RNA polymerase II transcription subunit 26 isoform X1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU19205 True 225 lncRNA 0.53 2 29066111 29066388

Neighbor

gene id symbol gene type direction distance location
AMCG00016738 NA coding downstream 41593 29021627 ~ 29024518 (-)
AMCG00016736 dlx3,dlx3b coding downstream 112315 28949450 ~ 28953796 (-)
AMCG00016733 s2540,LOC106601558,LOC108434938 coding downstream 327508 28725609 ~ 28738603 (-)
AMCG00016727 NA coding downstream 547363 28509826 ~ 28518748 (-)
AMCG00016726 LOC105890724,LOC107754311,LOC108413653,LOC108261365,LOC107694956 coding downstream 573495 28477514 ~ 28492616 (-)
AMCG00016741 NA coding upstream 125346 29191734 ~ 29201720 (-)
AMCG00016743 nsf,LOC107601245,LOC108260232,LOC107688085 coding upstream 199371 29265759 ~ 29288483 (-)
AMCG00016742 LOC104926834,LOC100703712,LOC108442534,LOC107688086,LOC107709998,LOC107601249 coding upstream 247000 29313388 ~ 29322785 (-)
AMCG00016744 myo1d,LOC107743773,LOC107677861,LOC106908042 coding upstream 289804 29356192 ~ 29362007 (-)
AMCG00016748 NA coding upstream 306264 29372652 ~ 29405744 (-)
G15365 fam171a2,LOC106600878,LOC106607454 non-coding downstream 370191 28695698 ~ 28695920 (-)
G15364 NA non-coding downstream 383773 28681838 ~ 28682338 (-)
G15330 NA non-coding downstream 614479 28451398 ~ 28451632 (-)
G15291 NA non-coding downstream 779666 28284362 ~ 28286445 (-)
G15254 NA non-coding downstream 905171 28160687 ~ 28160940 (-)
G15525 NA non-coding upstream 194924 29261312 ~ 29264667 (-)
G15585 NA non-coding upstream 736507 29802895 ~ 29807133 (-)
G15673 psme3,LOC106589310,LOC107706898,LOC107669474 non-coding upstream 972402 30038790 ~ 30041875 (-)
G15675 NA non-coding upstream 976187 30042575 ~ 30044565 (-)
G15690 NA non-coding upstream 1043065 30109453 ~ 30113284 (-)
AMCG00016732 NA other downstream 280604 28781472 ~ 28785507 (-)
AMCG00016712 NA other downstream 908911 28130012 ~ 28157200 (-)
G15076 NA other downstream 1637460 27424893 ~ 27428651 (-)
G15067 NA other downstream 1662189 27401676 ~ 27403922 (-)
G15026 NA other downstream 1695972 27369590 ~ 27370139 (-)
AMCG00016740 ormdl3,LOC108273759,LOC107723636,LOC107657273,LOC107556587,LOC102217224,LOC106521946 other upstream 135484 29201872 ~ 29225587 (-)
G15706 NA other upstream 1135071 30201459 ~ 30202351 (-)
G15787 NA other upstream 1459904 30526292 ~ 30529500 (-)
AMCG00016815 NA other upstream 2314159 31380547 ~ 31388268 (-)
AMCG00016847 NA other upstream 3195161 32261549 ~ 32267968 (-)

Expression


Co-expression Network