G17149



Basic Information


Item Value
gene id G17149
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information


Item Value
chromosome id CM030122.1
NCBI id CM030122.1
chromosome length 54868152
location 38340383 ~ 38340835 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence


>TU21262
CCTAAATTGCAGTATGCTACCATACATTATAGCCTTTTGGGTCAGACTCACAATTGATAGACTCGACTTGAGCACACTCCCCAGCGTTCCTCCTGCGATAACATTTGAAGGGGTATAGTGACGCAAATTGAAAGGGAAACAAAACGCATATAATACACAATGAGTGGCTGTATAATACTTACCTAAAAGCACAGGGTCTGACTTCGATGATGTCAAATTGCGATTAGAGTAGTTAATTGCCATGCTGCACGAATACTCCCCATCGTCACCAGAATCGGCAGAATCCTTTTTGTATGTAATGGAGTTAAACTTGTTCTCAAGGAACCTTGAGCCAAGCAGCGTGGAAATGGTGCTGCCTGTTGTGGCATCAAAGCGGCTGTGATAGAAACTCAAGGTAGAATTGGCATACTCATCAGGTACAGTGCATGTGATGGTGAAGTTCCTGCCTGGAGT

Function


GO: NA

KEGG:

id description
ko04672 Intestinal immune network for IgA production

RNA


RNA id representative length rna type GC content exon number start site end site
TU21262 True 453 lncRNA 0.44 1 38340383 38340835
Loading

Neighbor


gene id symbol gene type direction distance location
AMCG00016967 NA coding downstream 120546 38182302 ~ 38219837 (-)
AMCG00016961 NA coding downstream 166059 38171152 ~ 38174324 (-)
AMCG00016962 NA coding downstream 176723 38149505 ~ 38163660 (-)
AMCG00016963 LOC108427613,LOC103025619,LOC104955611,LOC104930301,LOC103373509,LOC100704252 coding downstream 194250 38141761 ~ 38146133 (-)
AMCG00016964 NA coding downstream 225637 38092049 ~ 38114746 (-)
AMCG00016968 NA coding upstream 19699 38360534 ~ 38371250 (-)
AMCG00016969 NA coding upstream 165321 38506156 ~ 38513767 (-)
AMCG00016977 LOC108436697 coding upstream 481273 38822108 ~ 38893519 (-)
AMCG00016978 sec13,LOC107557974 coding upstream 877989 39218824 ~ 39237899 (-)
AMCG00016987 pcbp4,LOC108436686,LOC107677040,LOC107708490,LOC107567193 coding upstream 1486405 39827240 ~ 39855114 (-)
G17148 NA non-coding downstream 508 38339575 ~ 38339875 (-)
G17140 NA non-coding downstream 14346 38325250 ~ 38326037 (-)
G17094 NA non-coding downstream 223128 38089679 ~ 38117255 (-)
G17039 NA non-coding downstream 481859 37858324 ~ 37858524 (-)
G17033 NA non-coding downstream 524366 37815577 ~ 37816017 (-)
G17164 NA non-coding upstream 44986 38385821 ~ 38386161 (-)
G17166 NA non-coding upstream 50835 38391670 ~ 38392072 (-)
G17170 NA non-coding upstream 52246 38393081 ~ 38393320 (-)
G17171 NA non-coding upstream 53666 38394501 ~ 38395819 (-)
G17225 NA non-coding upstream 366249 38707084 ~ 38730835 (-)
AMCG00016959 NA other downstream 281444 37875250 ~ 38058939 (-)
G17032 NA other downstream 581912 37758157 ~ 37758471 (-)
AMCG00016938 NA other downstream 2941353 35395992 ~ 35399030 (-)
G16563 NA other downstream 4232442 34106690 ~ 34107941 (-)
AMCG00016891 limd2,LOC107674139,LOC107658411 other downstream 4826804 33488725 ~ 33513579 (-)
G17421 NA other upstream 2875816 41216651 ~ 41217231 (-)
AMCG00017014 NA other upstream 3596091 41936926 ~ 41938563 (-)
G17842 NA other upstream 4467876 42808711 ~ 42864616 (-)
AMCG00017051 NA other upstream 4608156 42948991 ~ 42974433 (-)
AMCG00017061 NA other upstream 4939402 43280237 ~ 43286603 (-)

Expression


G17149 Expression in all Baseline Samples

Bar chart with 16 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 60.
End of interactive chart.

G17149 Expression in each Bioproject

Bar chart with 7 bars.
G17149 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network