G18196 (usp4)


Basic Information

Item Value
gene id G18196
gene name usp4
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030122.1
NCBI id CM030122.1
chromosome length 54868152
location 44669423 ~ 44670878 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU22555
ACTGGGAAATCTACCACAGTGTCCAGCTTGTCTCTCCAGCAGCGGTTATAAGAGAAGCGTTTCAAATGTACTACCAGGATGCGAGGCAGTGACCACAGATCAAACTTTTTTGTAGCCTGCTGATGTTTTTTGCAAGTGGGGCAATACCTGTACAGACAGGGGTCATGTTCTCCCAGTGTCTCCATTGTGGTGAAAAGCTCAATGCACTCCCTCAGGGCCACGGTGGCCTTCTTCTTCTGGTGCTGCAGCATGCTCTCATGCTTCTCAAAG

Function

symbol description
usp4 Predicted to enable thiol-dependent deubiquitinase. Acts upstream of or within convergent extension; negative regulation of toll-like receptor signaling pathway; and protein deubiquitination. Predicted to be located in cytoplasm. Predicted to be active in nucleus. Orthologous to human USP4 (ubiquitin specific peptidase 4).

NR:

description
PREDICTED: ubiquitin carboxyl-terminal hydrolase 4

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU22555 True 270 lncRNA 0.50 2 44669423 44670878

Neighbor

gene id symbol gene type direction distance location
AMCG00017088 LOC100694221,LOC104965620,LOC102796420,LOC101486183,LOC103385919 coding upstream 10509 44656787 ~ 44658914 (+)
AMCG00017084 NA coding upstream 191633 44468119 ~ 44477790 (+)
AMCG00017083 NA coding upstream 215929 44445621 ~ 44453494 (+)
AMCG00017082 NA coding upstream 258084 44388912 ~ 44411339 (+)
AMCG00017081 NA coding upstream 283437 44372888 ~ 44385986 (+)
AMCG00017090 LOC103399082 coding downstream 22105 44692983 ~ 44714100 (+)
AMCG00017096 NA coding downstream 44513 44715391 ~ 44739801 (+)
AMCG00017102 grm2,LOC106565576 coding downstream 197036 44867914 ~ 44876540 (+)
AMCG00017097 grm2,LOC105017167,LOC106565576,LOC106583186 coding downstream 210987 44881865 ~ 44891870 (+)
AMCG00017098 NA coding downstream 231588 44902466 ~ 44923634 (+)
G18127 NA non-coding upstream 281474 44387443 ~ 44387949 (+)
G18125 NA non-coding upstream 292195 44376993 ~ 44377228 (+)
G18084 NA non-coding upstream 468385 44116966 ~ 44201038 (+)
G18077 NA non-coding upstream 566024 44102026 ~ 44103399 (+)
G17987 LOC107575789 non-coding upstream 1168947 43500170 ~ 43500476 (+)
G18197 NA non-coding downstream 414 44671292 ~ 44671870 (+)
G18255 NA non-coding downstream 314918 44985796 ~ 44986081 (+)
G18302 NA non-coding downstream 572606 45243484 ~ 45243983 (+)
G18316 NA non-coding downstream 855866 45526744 ~ 45527005 (+)
G18330 NA non-coding downstream 1111319 45782197 ~ 45782467 (+)
G18192 NA other upstream 13325 44654652 ~ 44656098 (+)
AMCG00017078 LOC106565757 other upstream 531492 44126214 ~ 44137931 (+)
G17697 NA other upstream 2271636 42391297 ~ 42397787 (+)
AMCG00016979 NA other upstream 5414933 39239073 ~ 39254490 (+)
G17193 NA other upstream 6165791 38496051 ~ 38503632 (+)
AMCG00017099 cav3,LOC107673475,LOC107749619,LOC107584510,LOC107577493 other downstream 278156 44949034 ~ 44961601 (+)
AMCG00017167 NA other downstream 4701144 49372022 ~ 49382218 (+)
AMCG00017173 NA other downstream 4731653 49402531 ~ 49403845 (+)
AMCG00017183 NA other downstream 5042589 49713467 ~ 49727567 (+)
G19113 NA other downstream 5881002 50551880 ~ 50552985 (+)

Expression


Co-expression Network