G18316


Basic Information

Item Value
gene id G18316
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030122.1
NCBI id CM030122.1
chromosome length 54868152
location 45526744 ~ 45527005 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU22717
CGTTTTTTGCCATGGGCAGAGTACGCCCAGAATTCCCTAACCAGTGCTTCTACAGGCCTCACCCCCTTTCAGTGTGTCTTAGGATACCAACCGCCTCTGTTTCCTTGGAATGAGGAATCCACCGAAATCCCAGCAGTTGATGATTGGTTCCATCGCAGTGCAGATGTCTGGAATGCAACACATGTCCGTTTCCATAGAGCTATCCACCGTCAAAAGACCTTGGCAGACCGTCATCGACAACCTGCTCCGCAATATCATCCAG

Function

GO: NA

KEGG:

id description
ko00270 Cysteine and methionine metabolism

RNA

RNA id representative length rna type GC content exon number start site end site
TU22717 True 262 lncRNA 0.51 1 45526744 45527005

Neighbor

gene id symbol gene type direction distance location
AMCG00017104 NA coding upstream 299068 45220114 ~ 45227676 (+)
AMCG00017103 NA coding upstream 592495 44933056 ~ 44934249 (+)
AMCG00017098 NA coding upstream 603110 44902466 ~ 44923634 (+)
AMCG00017097 grm2,LOC105017167,LOC106565576,LOC106583186 coding upstream 634874 44881865 ~ 44891870 (+)
AMCG00017102 grm2,LOC106565576 coding upstream 650204 44867914 ~ 44876540 (+)
AMCG00017113 NA coding downstream 416045 45943050 ~ 46096926 (+)
AMCG00017112 pdzrn3,LOC107584480,LOC107667029,LOC107680714,LOC106582849 coding downstream 702044 46229049 ~ 46245266 (+)
AMCG00017114 pdzrn3 coding downstream 785889 46312894 ~ 46327713 (+)
AMCG00017121 NA coding downstream 886397 46413402 ~ 46415356 (+)
AMCG00017120 NA coding downstream 889392 46416397 ~ 46419842 (+)
G18302 NA non-coding upstream 282761 45243484 ~ 45243983 (+)
G18255 NA non-coding upstream 540663 44985796 ~ 44986081 (+)
G18186 NA non-coding upstream 812580 44623367 ~ 44714164 (+)
G18197 NA non-coding upstream 854874 44671292 ~ 44671870 (+)
G18196 usp4 non-coding upstream 855866 44669423 ~ 44670878 (+)
G18330 NA non-coding downstream 255192 45782197 ~ 45782467 (+)
G18357 NA non-coding downstream 492336 46019341 ~ 46021345 (+)
G18363 NA non-coding downstream 574061 46101066 ~ 46101623 (+)
G18365 NA non-coding downstream 578592 46105597 ~ 46106518 (+)
G18386 NA non-coding downstream 844962 46371967 ~ 46372406 (+)
AMCG00017099 cav3,LOC107673475,LOC107749619,LOC107584510,LOC107577493 other upstream 565143 44949034 ~ 44961601 (+)
G18192 NA other upstream 870646 44654652 ~ 44656098 (+)
AMCG00017078 LOC106565757 other upstream 1388813 44126214 ~ 44137931 (+)
G17697 NA other upstream 3128957 42391297 ~ 42397787 (+)
AMCG00016979 NA other upstream 6272254 39239073 ~ 39254490 (+)
AMCG00017167 NA other downstream 3845017 49372022 ~ 49382218 (+)
AMCG00017173 NA other downstream 3875526 49402531 ~ 49403845 (+)
AMCG00017183 NA other downstream 4186462 49713467 ~ 49727567 (+)
G19113 NA other downstream 5024875 50551880 ~ 50552985 (+)
G19114 raf1,LOC108276324 other downstream 5032445 50559450 ~ 50563278 (+)

Expression


Co-expression Network