AMCG00017395 (tlx2,LOC106611621,LOC106604594)


Basic Information

Item Value
gene id AMCG00017395
gene name tlx2,LOC106611621,LOC106604594
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030131.1
NCBI id CM030131.1
chromosome length 33043351
location 1555528 ~ 1561186 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00017395
GTTTTGTATTCATTCCTCTCCCTGGCAGCTGCCCTATCACCGTTCTCAGTGACTCGGAGGATTGGTCATCCCTATCAAAATCGGACGCCCCCTAAGAGGAAAAAGCCCAGGACATCTTTCAGCCGGGTGCAGATCTGTGAACTCGAGAAGCGCTTCCACCGGCAGAAGTACCTGGCATCTGCGGAACGGGCCACTCTGGCCAAAGCACTGAAGATGACTGATGCACAAGTCAAGACCTGGTTCCAGAACAGGAGGACTAAATGGCGGAGGCAGACCGCAGAGGAGCGCGAAGCCGAAAGGCAGCAGGCAAATCGGCTGATGCTGCAGCTCCAGCAGGAGGCTTTCCAGAAGACCCTGAGTCAGCCCTTGCAGCAGGACCCTCTCTGTCTGCACAACTCCTCCCTGTATGCCCTGCAGAACCTCCAGCCTTGGGCCGATGACAACAAAGTCACCTCAGTCACATCTGTGGCTTCTGTGGTCTGA

Function

symbol description
tlx2 Predicted to enable DNA-binding transcription factor activity, RNA polymerase II-specific and RNA polymerase II cis-regulatory region sequence-specific DNA binding activity. Acts upstream of or within inner ear development. Predicted to be active in nucleus. Is expressed in Rohon-Beard neurons; inner ear; and statoacoustic (VIII) ganglion. Orthologous to human TLX2 (T cell leukemia homeobox 2).

NR:

description
PREDICTED: T-cell leukemia homeobox protein 3-like isoform X3

GO:

id name namespace
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0005634 nucleus cellular_component
GO:0043565 sequence-specific DNA binding molecular_function
GO:0003700 DNA-binding transcription factor activity molecular_function

KEGG:

id description
K15607 TLX3, HOX11L2; T-cell leukemia homeobox protein 3

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00017395 True 483 mRNA 0.56 2 1555528 1561186

Neighbor

gene id symbol gene type direction distance location
AMCG00017394 LOC106604596,LOC105028255,LOC106611619,LOC103363938,LOC104951404 coding downstream 107947 1438528 ~ 1447581 (-)
AMCG00017393 pcgf1,LOC107589114,LOC107710472,LOC107660820 coding downstream 266095 1275232 ~ 1289433 (-)
AMCG00017391 NA coding downstream 618852 935881 ~ 936676 (-)
AMCG00017387 NA coding downstream 1085098 360455 ~ 470430 (-)
AMCG00017396 NA coding upstream 38402 1599588 ~ 1600290 (-)
AMCG00017397 NA coding upstream 39405 1600591 ~ 1601058 (-)
AMCG00017400 NA coding upstream 143760 1704946 ~ 1707277 (-)
AMCG00017401 NA coding upstream 210227 1771413 ~ 1781208 (-)
AMCG00017409 loxl3,LOC106612874 coding upstream 375936 1937122 ~ 1946925 (-)
G89940 NA non-coding downstream 196547 1358684 ~ 1358981 (-)
G89939 NA non-coding downstream 214439 1340872 ~ 1341089 (-)
G89912 NA non-coding downstream 516057 1039272 ~ 1039471 (-)
G89909 nanos1,nano1,LOC105894108,LOC106611616 non-coding downstream 584100 968543 ~ 971428 (-)
G89900 NA non-coding downstream 643880 911396 ~ 911648 (-)
G90017 NA non-coding upstream 266494 1827680 ~ 1831528 (-)
G90066 LOC107678491 non-coding upstream 364022 1925208 ~ 1926851 (-)
G90093 NA non-coding upstream 493653 2054839 ~ 2055363 (-)
G90098 NA non-coding upstream 517854 2079040 ~ 2079244 (-)
G90129 NA non-coding upstream 624199 2185385 ~ 2185739 (-)
AMCG00017384 LOC106911887,LOC104963986 other downstream 1203742 160054 ~ 351786 (-)
G89804 NA other downstream 1449643 105685 ~ 105885 (-)
AMCG00017418 NA other upstream 1040597 2601783 ~ 2615562 (-)
AMCG00017426 NA other upstream 1150116 2711302 ~ 2841894 (-)
G90400 NA other upstream 2981589 4542775 ~ 4544760 (-)
G90501 NA other upstream 3597198 5158384 ~ 5221021 (-)
G90502 NA other upstream 3661287 5222473 ~ 5223047 (-)

Expression


Co-expression Network