AMCG00017404 (htra2,LOC106589831,LOC101079124,LOC105899646,LOC108441752)


Basic Information

Item Value
gene id AMCG00017404
gene name htra2,LOC106589831,LOC101079124,LOC105899646,LOC108441752
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030131.1
NCBI id CM030131.1
chromosome length 33043351
location 1923477 ~ 1933451 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00017404
CACCCCCTTCCAACTCTACCACTGGGGCTGTCCTCAGAGGTGCGGCAGGGAGAGTTTGTGGTAGCCATGGGAAGCCCTTTCTCTCTGCGCAACACCATAACTTCAGGGATCGTGAGCTCCGTGCAGAGAGGCAGCAGAGAGCTTGGCCTCTCCAACAGTAACATGGACTACATTCAGACCGACGCAGCCATTGATGTAGGTAGTAATTTGGGCATCATTTCGGAGCTGAAAGTACGTGACCCTATCTTCCAAGATGTGACCCATGGAGTCCTGATTCACAAGATAATCATGGGTTCCCCAGCCAACAGGGCTGGGATGAAACCTGGTGATATAGTTGTGGAGATCAATGGGAAAACGGTGAAGACTGCAGAAGACATCTACAACACGGTGCTAACTTCAGACAGCATTAACATGGTTGTAAAACGAGGGCCTGATCTGCTCATGCTGCACATGACTCCTGAGTTTGTAGAGTGA

Function

symbol description
htra2 Enables identical protein binding activity and serine-type endopeptidase activity. Involved in several processes, including cellular response to interferon-beta; cellular response to retinoic acid; and positive regulation of extrinsic apoptotic signaling pathway in absence of ligand. Located in several cellular components, including chromatin; cytosol; and mitochondrial intermembrane space. Part of serine-type endopeptidase complex. Implicated in 3-methylglutaconic aciduria type 8; Parkinson's disease; and motor neuron disease. Biomarker of Alzheimer's disease; endometrial cancer; ovarian cancer; prostate cancer; and stomach cancer.

NR:

description
PREDICTED: serine protease HTRA2, mitochondrial isoform X1

GO:

id name namespace
GO:0006508 proteolysis biological_process
GO:0004252 serine-type endopeptidase activity molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00017404 True 474 mRNA 0.51 3 1923477 1933451

Neighbor

gene id symbol gene type direction distance location
AMCG00017403 NA coding upstream 29015 1876676 ~ 1894462 (+)
AMCG00017402 NA coding upstream 48049 1872627 ~ 1875428 (+)
AMCG00017398 NA coding upstream 154629 1758386 ~ 1768848 (+)
AMCG00017399 NA coding upstream 187455 1734432 ~ 1736022 (+)
AMCG00017392 lbx2,LOC105028271,LOC106604581,LOC106611617 coding upstream 656143 1265442 ~ 1267334 (+)
AMCG00017405 NA coding downstream 114226 2047677 ~ 2049406 (+)
AMCG00017412 NA coding downstream 174440 2107891 ~ 2129512 (+)
AMCG00017413 fgfr3 coding downstream 494442 2427893 ~ 2460519 (+)
AMCG00017415 LOC103458261,LOC105909588 coding downstream 640038 2573489 ~ 2598970 (+)
AMCG00017416 NA coding downstream 712823 2646274 ~ 2649483 (+)
G89983 NA non-coding upstream 333672 1580983 ~ 1589805 (+)
G89938 NA non-coding upstream 582182 1340901 ~ 1341295 (+)
G89913 NA non-coding upstream 811318 1111954 ~ 1112159 (+)
G89908 NA non-coding upstream 952213 970643 ~ 971264 (+)
G89901 NA non-coding upstream 1008264 915003 ~ 915213 (+)
G90070 NA non-coding downstream 69587 2003038 ~ 2004606 (+)
G90144 NA non-coding downstream 528431 2461882 ~ 2504164 (+)
G90149 NA non-coding downstream 558456 2491907 ~ 2528801 (+)
G90248 NA non-coding downstream 1303994 3237445 ~ 3237726 (+)
G90284 NA non-coding downstream 1964367 3897818 ~ 3898125 (+)
AMCG00017388 LOC108267694,LOC106608525 other upstream 1711541 207586 ~ 211936 (+)
AMCG00017386 dctn1,LOC101464740 other upstream 1825080 48007 ~ 98397 (+)
AMCG00017422 leprotl1,LOC103152176 other downstream 753969 2687420 ~ 2695453 (+)
AMCG00017445 NA other downstream 2659351 4592802 ~ 4606571 (+)
AMCG00017446 NA other downstream 2729174 4662625 ~ 4688223 (+)
AMCG00017486 NA other downstream 4796287 6729738 ~ 7188643 (+)
G90877 NA other downstream 5734732 7668183 ~ 7671850 (+)

Expression


Co-expression Network