AMCG00017431 (ctnna2,LOC102793143,LOC107706127,LOC103137875)


Basic Information

Item Value
gene id AMCG00017431
gene name ctnna2,LOC102793143,LOC107706127,LOC103137875
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030131.1
NCBI id CM030131.1
chromosome length 33043351
location 3529683 ~ 3539396 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00017431
ATTTCTGTTTTACTCTTGCAGACTGGCAGAAAAGAGAAAGGAGACCCACTTAACACCGCCATTGACAAGATGACCAAAAAAACAAGGGACCTCCGAAGACAGCTGCGGAAGGCAGTGATGGACCACATCTCTGACTCCTTCTTAGAGACAAATGTGCCCCTGCTTGTGCTCATTGAGGCTGCAAAGAGCGGCAATGAAAAGGAGGTCAAAGAGTATGCCCAGGTCTTCCGTGAGCATGCCAACAAGCTCGTCGAG

Function

symbol description
ctnna2 Predicted to enable several functions, including actin filament binding activity; beta-catenin binding activity; and cadherin binding activity. Predicted to be involved in several processes, including brain morphogenesis; neuron projection morphogenesis; and regulation of synapse structural plasticity. Predicted to act upstream of or within actin filament organization; cell differentiation; and epithelial cell-cell adhesion. Predicted to be located in adherens junction; axon; and cytoplasm. Is expressed in female organism. Human ortholog(s) of this gene implicated in complex cortical dysplasia with other brain malformations. Orthologous to human CTNNA2 (catenin alpha 2).

NR:

description
PREDICTED: catenin alpha-2-like isoform X2

GO:

id name namespace
GO:0007155 cell adhesion biological_process
GO:0015629 actin cytoskeleton cellular_component
GO:0005198 structural molecule activity molecular_function
GO:0045296 cadherin binding molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00017431 True 255 mRNA 0.49 2 3529683 3539396

Neighbor

gene id symbol gene type direction distance location
AMCG00017430 ctnna2 coding downstream 42158 3429621 ~ 3487525 (-)
AMCG00017425 NA coding downstream 442033 2841922 ~ 3087650 (-)
AMCG00017417 letm1 coding downstream 963406 2528915 ~ 2566277 (-)
AMCG00017414 NA coding downstream 1102556 2076178 ~ 2427127 (-)
AMCG00017406 NA coding downstream 1497467 2023432 ~ 2032216 (-)
AMCG00017434 ctnna2,ctnna1,LOC107594905,LOC107750356 coding upstream 198417 3737813 ~ 3747843 (-)
AMCG00017432 ctnna2,LOC107552348,LOC103137937,LOC107706127 coding upstream 237098 3776494 ~ 3799472 (-)
AMCG00017437 NA coding upstream 368056 3907452 ~ 3908488 (-)
AMCG00017438 NA coding upstream 369117 3908513 ~ 3909212 (-)
AMCG00017436 NA coding upstream 664290 4203686 ~ 4204261 (-)
G90255 LOC100846954 non-coding downstream 124917 3404486 ~ 3404766 (-)
G90252 NA non-coding downstream 174194 3355065 ~ 3355489 (-)
G90244 NA non-coding downstream 589540 2939935 ~ 2940143 (-)
G90243 NA non-coding downstream 590206 2939250 ~ 2939477 (-)
G90226 NA non-coding downstream 692885 2836519 ~ 2836798 (-)
G90281 NA non-coding upstream 132899 3672295 ~ 3685214 (-)
G90287 NA non-coding upstream 415492 3954888 ~ 3955136 (-)
G90289 NA non-coding upstream 502291 4041687 ~ 4041894 (-)
G90307 NA non-coding upstream 663211 4202607 ~ 4202807 (-)
G90354 NA non-coding upstream 807590 4346986 ~ 4347291 (-)
AMCG00017426 NA other downstream 687789 2711302 ~ 2841894 (-)
AMCG00017418 NA other downstream 914121 2601783 ~ 2615562 (-)
AMCG00017384 LOC106911887,LOC104963986 other downstream 3177897 160054 ~ 351786 (-)
G89804 NA other downstream 3423798 105685 ~ 105885 (-)
G90400 NA other upstream 1003379 4542775 ~ 4544760 (-)
G90501 NA other upstream 1618988 5158384 ~ 5221021 (-)
G90502 NA other upstream 1683077 5222473 ~ 5223047 (-)
G90715 fat4,LOC106611628,LOC106604622 other upstream 2847856 6387252 ~ 6389038 (-)
G90746 NA other upstream 3193839 6733235 ~ 7188648 (-)

Expression


Co-expression Network